Ақпарат

Субгеномдық промотор дегеніміз не?

Субгеномдық промотор дегеніміз не?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Мен «субгеномдық промотор» терминінің жақсы анықтамасын іздеймін. Біреу маған көмектесе алады ма?


Субгеномдық промотор – белгілі бір гетерологиялық ген үшін вирусқа қосылатын промотор, нәтижесінде тек осы ген үшін мРНҚ түзіледі. Көптеген оң мағыналы РНҚ вирустары осы субгеномдық мРНҚ-ларды (sgRNA) осы вирустар қолданатын жалпы инфекция әдістерінің бірі ретінде жасайды және әдетте кеш вирустық гендерді транскрипциялайды. Doi сайтынан: 10.1128/jvi.74.13.5988-5996.2000

Сондықтан бұл белгілі бір гендерді экспрессиялауға көмектесетін қосымша промоутер сияқты. Көбінесе вирустық инженерияда пайдалы.


Субгеномдық мРНҚ

Альфавирустардың және қызамық вирусының субгеномдық мРНҚ-лары полипротеиндер деп аударылады, бірақ полипротеинді өңдеу екеуінің арасында ерекшеленеді. Альфавирустармен капсид ақуызы цитоплазмада E2 прекурсорынан (PE2 немесе P62 ретінде белгілі) автопротеолитикалық жолмен бөлінеді, ал қалған полипротеин N-байланыстырылған олигосахаридтердің қосылуы орын алатын ER люменіне ауыстырылады. Бастапқыда ER мембранасында орналасқан 6К гидрофобты протеин содан кейін хост сигналазасы арқылы полипротеиннен бөлінеді. Қызамық вирусымен капсид-Е2 және Е2-Е1 бөлінуі сигналаза арқылы аяқталады. Сонымен қатар, қызамық вирусында 6K ақуызы жоқ және жетілген E2 ER-де өндіріледі. Альфавирус PE2 және E1 ақуыздары трансмембраналық домендерімен бекітілген ER-де гетеродимерлер құрайды және интрамолекулярлық дисульфидті байланыстарды және Bip және калнексин/калретикулин сияқты қабылдаушы шаперон ақуыздарымен байланыстарды қамтиды. PE2/E1 гетеродимерлері цитоплазмалық мембранаға жіберіледі, ал ПЭ2 фурин тәрізді протеаза арқылы жетілген E2-ге ыдырайды. транс Гольджи торы және жасуша беті. Бөлінген E3 фрагменті кейбір (мысалы, SINV), бірақ барлық (мысалы, SFV) вирус бөлшектерінен жоғалады. Құрамында PE2 бар вириондар омыртқалы жануарлардың жасушаларынан қалыпты түрде бүршіктенетін сияқты, бірақ көбінесе жасуша синтезіне байланысты конформациялық қайта құрылымда ақаулы болып табылады, бұл секреторлық жолдағы төмен рН экспозициясы кезінде PE2 болуы гликопротеин гетеродимерін тұрақтандырады деген гипотезаны қолдайды.

Бөлшектердің бүршіктері С және E2 цитоплазмалық құйрығы арасындағы өзара әрекеттесу арқылы жүреді, алайда бұл өзара әрекеттесу секреторлық жолдың қай нүктесінде болатыны және өзара әрекеттесу С мономерлері, олигомерлері немесе РНҚ-құрамында алдын ала түзілген нуклеокапсидтер арасында екені белгісіз. Альфавирустармен РНҚ қаптамасы вирусқа байланысты nsP1 немесе nsP2 гендеріндегі РНҚ қайталама құрылымы арқылы бағытталады, бұл геномның молярлық артық болатын субгеномның үстінен таңдамалы қаптамасына әкеледі. Қабылданған модельде соңғы бүршіктену цитоплазмалық мембранада E2/E1 гетеродимерлерімен байытылған жерлерде орын алады және негізгі липидті қос қабаттың экструзиясына, бөлшектің қабығына және босатуға мәжбүрлейтін E2 құйрық-C әрекеттесулерімен қозғалады.


Бром-мозаикалық вирустың РНҚ рекомбинациясы арқылы субгеномдық промоторлық тізбектерге қойылатын талаптарды in vivo бөлу: транскрипция мен рекомбинацияның функционалды бөлінуінің дәлелі

Бұрын біз және басқалар бром мозаикалық вирусының (BMV) RNA3-тегі субгеномдық промотор (sgp) аймағында гомологиялық рекомбинация белсенділігінің жоғарылауын көрсеттік. sgp-делдалдық рекомбинация мен транскрипцияны корреляциялау үшін осы жұмыста біз өзгертілген sgp қайталануларын тасымалдайтын BMV RNA3 конструкцияларын қолдандық. Біз поли(U) трактінің жойылуы немесе ұзартылуы тиісінше рекомбинацияны азайтатынын немесе жоғарылағанын байқадық. sgp негізгі шаш қыстырғышын жою немесе оны басқа діңгек-ілмек құрылымымен ауыстыру рекомбинация белсенділігін тежеді. +1 немесе +2 транскрипцияны бастау позициясындағы нуклеотидтерді алмастыру рекомбинацияны төмендетеді. sgp өзегі тек базальды рекомбинация белсенділігін ғана қолдады. Кроссовер сайттары поли(U) аймағына және негізгі шаш қыстырғышына салыстырылады. Рекомбинацияға байқалған әсерлер транскрипцияда байқалған әсерлерге параллель болмады. Екі әрекеттің де sgp тізбегінде қалай жұмыс істейтінін түсіндіру үшін біз қос механизмді ұсынамыз, оның көмегімен рекомбинация поли(U) трактінде алдын ала бөлінген пайда болған плюс жіппен басылады, ал транскрипция sgp өзегінде де жаңадан басталады.

Фигуралар

BMV RNA3 конструкциялары (ID RNA3s)…

Осы зерттеулерде пайдаланылған BMV RNA3 конструкциялары (ID RNA3s). Схемасы…

BMV RNA3 конструкциялары (ID RNA3s)…

Осы зерттеулерде пайдаланылған BMV RNA3 конструкциялары (ID RNA3s). Схемасы…

Гомологтық кроссоверлердің жалпы суреті…

Идентификатор RNA3 екі коинокулятталған нұсқалары арасында орын алатын гомологиялық кроссоверлердің жалпы суреті.…

(A) Northern Blot талдауы…

(A) BMV RNA3 идентификаторы құрылымдарының жинақталуының солтүстік блот талдауы. Жапырақтары…

(A) Northern Blot талдауы…

(A) BMV RNA3 идентификаторы құрылымдарының жинақталуының солтүстік блот талдауы. Жапырақтары…

RT-ПТР жасалған секвенирлеу нәтижелері…

BMV RNA3 ұрпақтарының RT-ПТР-генерацияланған cDNA клондарының секвенирлеу нәтижелері…

Айқасатын тораптарды картаға түсіру…

ID1 ×… негізіндегі поли(U) трактіне кроссовер тораптарын салыстыру

Модельдің диаграммалық көрінісі…

sgp аймағындағы кроссовер моделінің диаграммалық көрінісі. Қалың сызықтар,…


НӘТИЖЕЛЕР

Дәл субгеномдық бастама.

Субгеномдық негізгі промотордың құрамындағы тану элементтерін анықтау үшін 33-нттық проскрипт (�⼓) құрастырылды, оның құрамында (−)-да субгеномдық инициацияның басталу орнының 20 nt 3′ WT промоторы тізбегі бар. тізбекті РНҚ3. Бұл проскрипт 13 нт өнімінің синтезін басқарады, оның алғашқы 11 нті BMV тізбегі, одан кейін RdRp өнімдерін [α- 32 PלTP бар таңбалауға мүмкіндік беру үшін T7 РНҚ-полимераза арқылы қосылған екі гуанилат. �⼓ проскриптіндегі BMV тізбегі 1,222-ден 1,252-ге дейінгі позициялардан вирустық (+) RNA3 тізбегіне қосымша болып табылады және WT бақылауы ретінде қызмет етеді (​-сурет (1-сурет). А).

РНҚ синтезін дәл және тиімді бастау үшін қажет BMV субгеномдық промоторындағы аймақтар. (А) Үштік трансверсиялық мутанттар. Көрсетілген реттілік 13 nt өнімнің синтезін басқаратын WT BMV негізгі промоторы бар проскрипт �⼓. Үш топтағы нуклеотидтердің өзгерістері проскрипттерде жақшалармен және мутант нуклеотидтер WT тізбегінің астында көрсетіледі. Қайталанатын реакциялардағы енгізу үлгілерінің сәйкестігі гельдің жоғарғы жағында көрсетілген. Реакция өнімдері денатурациялау PAGE (1-жолақтар) арқылы бөлінген және авторрадиография арқылы визуалды. Бір нуклеотидтің үлгіленбеген қосылуына байланысты, мүмкін RdRp арқылы 13 nt өлшемді маркермен (M жолағы) салыстыру арқылы бағаланған басым RdRp өнімі 14 nt болды. Lane φ ешқандай шаблонсыз басқару реакциясының өнімдерін білдіреді. Белсенділік үшін қажетті субгеномдық промотор аймағы гельдің астында жақшада көрсетілген. (Б) РНҚ синтезін дәл бастау үшін реттілік талаптары. WT промоторларының реті жоғарыда көрсетілген. Бастау реті өзгертілген РНҚ төменде көрсетілген. Бастауыш нуклеотид (WT немесе мутант) көрсеткі және үлкенірек өлшемді шрифтпен белгіленеді. STD стандартты RdRp реакциясының өнімдерін көрсетеді (1, 4 және 7 жолақтар) және GTP жоқ реакциялар −GTP (3, 6 және 9 жолақтар) арқылы көрсетіледі. RdRp өнімдерінің RNase T1 қорытылуы +T1 (2, 5 және 8 жолақтар) арқылы көрсетілген. Өлшем маркерлері (M жолағы) RdRp өнімдерінің өлшемін көрсетеді, ешқандай шаблонсыз реакциялардан алынған өнімдер (жолағы φ) көрсетілген.

Промоторлар тізбегіндегі әртүрлі мутациялар жасалды. Бастапқыда үш нуклеотидтен тұратын топтарда трансверсиялар бүкіл промоторды сканерлеу және РНҚ синтезі үшін қандай аймақтар қажет екенін анықтау үшін синтезделді. � – 𢄩 позициялары маңызды нуклеотидтерден тұратыны анықталды, өйткені промотордың осы аймағындағы мутациялар BMV RdRp-тің субгеномдық РНҚ синтезін WT белсенділігінің шамамен 2%-ке дейін инициациялау қабілетін төмендетті (Cурет ​). 1-сурет А, жолақтар 5�). Нуклеотидтер позицияларындағы 𢄥 – 𢄣 мутациялар WT белсенділігінің 16% сақтай отырып, азырақ әсер етті (Cурет ​ (Cурет 1 1). А, 13 және 14 жолақтар). Өзек промоторының барлық басқа позицияларын қамтитын үш нуклеотидті трансверсияның әрқайсысы синтезді тек 50-ке төмендетті. Барлық үлгілердегі басым RdRp өнімі бір нуклеотидтің үлгісіз қосылуына байланысты 14 nt болды, бұл барлық ДНҚ-тәуелді РНҚ полимеразаларына және полиовирус RdRp (11) үшін ортақ құбылыс.

Күтпеген жерден субгеномдық синтезге нуклеотидтерді 𢄢 𢄢 ʱ инициация алаңына ауыстыру салыстырмалы түрде әсер етпеді (Cурет 1). ​ 1 1 A, 15 және 16 жолақтар). Алдыңғы жұмыс субгеномдық RNA4 үшін инициаторлық цитидилаттың идентификациясын сақтау керек екенін көрсетті (6). 𢄢ʱ прокриптіндегі үш нуклеотидті трансверсия цитидилатты 𢄡 позициясына орналастырады және BMV RdRp бұл нуклеотидті WT проскрипті сияқты бірдей өлшемдегі өнімді басқаратын РНҚ синтезін бастау үшін пайдалана алады деп болжауға болады. не үлгіленбеген гуанилатты (ʱ позициясындағы үлгіленген цитидилдің орнына) пайдалануды жеңілдету арқылы немесе ʱ позициясын толығымен айналып өту арқылы. Бастау орнын жылжытуға болатынын тексеру үшін екі қосымша проскрипт жасалды (Cурет ​ (Cурет 1 1) Б). Proscript ʱ C/G WT реттілігі ретінде барлық басқа позицияларды қалдыра отырып, инициаторлық цитидилатты гуанилатпен арнайы ауыстырады. Proscript 𢄡/ʱ G инициация орнына гуанилатты енгізеді және WT ʱ цитидилатын ʲ позициясына жылжытады. Бұл проскрипт BMV RdRp арқылы ʱ позициясына енгізілген гуанилат танылса, 14 nt өнімді кодтайды (үлгіленбеген қосумен 15 nt). Дегенмен, егер инициация орнын қазір ʲ позициясын алып жатқан цитидилатқа ауыстыруға болатын болса, онда 13 нт өнімін (үлгіленбеген қосумен 14 nt) байқау керек. RdRp өнімдерінің дәл инициациясын тек бастау үшін қажет GTP ұстамау немесе гуанилаттардан кейін арнайы ыдырайтын RNase T1 өңдеу арқылы тексеруге болады. Осылайша, дұрыс іске қосылған RdRp өнімі RNase T1 қорытылуынан кейін 1 nt азаяды.

𢄢ʱ, 𢄡/ʱ G және WT �⼓ проскрипттерінен алынған RdRp өнімдері GTP және 𡈠⼓ GTP жетіспейтін реакциялар бойынша бағаланатындай GTP және �⼓ басталды. (Cурет 1 1 Б, жолақтар 1𠄹) және өлшемі T7 өлшемді маркерлермен бірдей (13 және 14 nt). Дегенмен, ʱ C/G проскриптінен ешбір өнім синтезделмеген (Cурет ​ (Cурет 1 1). Б, 10 жолақ). Сондықтан біз бұрынғы бақылауларға сәйкес инициациялық нуклеотид ретінде цитидилат қалдығы қажет деген қорытындыға келдік. BMV RdRp цитидилатты бір нуклеотид 3-де немесе бастапқы инициация орнына жақын орналасқан 5-те тани алатын сияқты (Cурет ​ (Cурет 1 1). Б, 4, 5, 7 және 8 жолақтар). Барлық реакциялар дәл бастауды көрсетеді және бұл жүйені RdRp-субгеномдық ядро ​​промоторларының өзара әрекеттесуін сипаттау үшін пайдалануды растайды. Бұл тәжірибелер сонымен қатар 14-nt өнімін тудыратын үлгіленбеген нуклеотидтің қосылуы (+)-тізбекті өнімнің 3′ соңында болатынын растайды.

Субгеномдық РНҚ синтезін бастау үшін маңызды нуклеотидтер.

Үш нуклеотидтік трансверсиядан алынған деректер � - 𢄩 позицияларында РНҚ синтезі үшін маңызды нуклеотидтер бар екенін көрсетті. Критикалық қалдықтарды анықтау үшін осы аймақтағы әрбір позицияда және субгеномдық өзек промоторының 𢄥- 𢄣 позицияларында бір нуклеотидтік трансверсиялары бар проскрипттер құрастырылды (Cурет ​ (Cурет 2 2). А). �, �, �, �, � және 𢄥 позициялар синтез үшін маңызды болды, өйткені трансверсиялар BMV RdRp (𶀞, �) арқылы РНҚ синтезін айтарлықтай төмендетті А, 2, 5, 6, 8, 9 және 11 жолақтар). Ең маңызды позициялар, �, �, �, және �, барлығында WT проскриптінің 3%-тен төмен әрекеттері болды. � және 𢄥 позицияларындағы өзгерістер WT синтезінің 31-18-ін сақтай отырып, ауыртпалықсыз болды. Теріс бақылау ретінде ʱ C/G проскриптінен синтез байқалмады, оның құрамында ʱ позициясында трансверсия бар (сурет ​ (2-сурет). А, 14-жол).

BMV субгеномдық ядро ​​промоторының мутациялық талдауы. Кіріс проскрипттерінің RdRp реакция өнімдері бар жолақтар әрбір схемада проскрипт атауларының жанында көрсетілген. Барлық өнімдер 20 денатурацияланатын полиакриламидті гельдерде бөлінген. Бұл авторадиографияларда күтілетін өлшемдердің RdRp өнімдерінен басқа жолақтар болмағандықтан, RdRp өнімдерін қамтитын авторадиографияның бөліктері ғана көрсетіледі. φ жолағы енгізу үлгісі жоқ реакциялардан жасалған өнімдерді көрсетеді, ал M жолағында күтілетін RdRp өнімімен бірдей реттілік T7 РНҚ полимеразасы арқылы жасалған 13 nt өлшемді маркер бар. Синтезді қолдайтын проскрипттерден алынған өнімдер өлшем маркерлерімен және WT құрылымымен салыстыру арқылы дұрыс іске қосылды. (А) Нуклеотидтердегі � – 𢄩, 𢄥 – 𢄣 және ʱ аралығындағы бір нуклеотидті трансверсия мутациялары. WT үлгісінің нуклеотидтер тізбегі (�⼓) және сәйкес өзгерістер жақшаға алынған бастапқы үш нуклеотидтік трансверсиямен көрсетілген. (Б) �, �, және � позицияларындағы барлық ықтимал нуклеотидтерді ауыстыру. WT проскриптінің тізбегі (�⼓) төменде көрсетілген тиісті өзгерістермен көрсетілген. (C) � және � позицияларындағы барлық ықтимал нуклеотидтерді ауыстыру. WT проскриптінің схемасы көрсетілген және келесі мутанттардың идентификациясы төменде көрсетілген.

Осы төрт позицияның реттілік ерекшелігін тексеру үшін ең маңызды позициялардағы, �, �, �, және �, мүмкін болатын барлық нуклеотидтерді ауыстыруды қамтитын проскрипттер тексерілді. WT гуанилатының � позициясында уридилатқа (� G/U) өзгеруі WT белсенділігінің 13% кезінде РНҚ синтезін қолдады (Cурет ​ (2-сурет). Б, 2-жол). � (� G˼ және � G˺) басқа нуклеотидтер алмастырулары РНҚ синтезін бағыттай алмады (Cурет ​ (2-сурет). Б, 1 және 3 жолақтар). � немесе � позицияларындағы WT тізбегінен басқа нуклеотидтер айтарлықтай белсенділікті сақтамады (Cурет ​ (Cурет 2 2). Б, жолақтар 4𠄹), аденилаттың � және цитидилаттың �-те маңыздылығын көрсетеді. WT гуанилатының позициясының уридилатқа немесе аденилатқа (� G/U немесе � G˺) өзгеруі шамамен 8% белсенділікті сақтады, ал бастапқы 𡈑 G𡈒 белсенділікті сақтады. WT проскриптінің белсенділігінің 1% (Cурет ​ (Cурет 2 2) C, жолақтар 1𠄳). Жоғарыда аталған төрт позицияның нақты талаптарын одан әрі көрсету үшін � позициясындағы WT гуанилаты зиянды әсерлері жоқ уридилатпен немесе аденилатпен ауыстырылды (Cурет ​ (Cурет 2 2). C, 5 және 6 жолақтар). Шын мәнінде, осы мутанттардың екеуі де, � G/U және 𡈐 G˺, �𡈠/ өнімінің 140% өнімін генерациялай отырып, WT проскриптіне қарағанда сәл жақсырақ промоторларға әкелді. Бұл нәтижелер BMV субгеномдық өзек промоторының �, �, � және � позицияларындағы нуклеотидтердің ерекшелігін көрсетеді.

Барлық мутациялық деректердің қысқаша мазмұны ​-суретте берілген.3 3-сурет. А. Ішінара белсенділік танытатын алмастырушы нуклеотидтердегі негіздің функционалдық бөліктерін зерттеу BMV RdRp таныған байланыс жерлерін болжайды. Бұл идеяны тексеру үшін �⼓, � G⼓, � G⼓, � G/U және � G� G� G/U WT промоутері бар екінші проскрипттің синтезіне тікелей синтез тізбегіне әсер ететінін анықтау үшін бәсекелестік эксперименттер жүргізілді. -nt өнімі (�⼕ белгіленген). Бәсекелес шаблондардың концентрациясы �⼕ проскриптінің 0,1-ден 10 есе молярлық асып кетуіне дейін өзгерді. Бәсекелестік 15 тн өнім мөлшерінің азаюымен 13 тн өнімінің бір мезгілде ұлғаюымен бейнеленді (Cурет ​ (Cурет 3 3). Б). Күтілгендей, проскрипт �⼓ синтез үшін тиімді бәсекелесті, өйткені оның құрамында WT субгеномдық промоторы да бар (Cурет ​ (Cурет 3 3). Б, жолақтар 4𠄸). x0221220 & # x0002f13 эквимолярной мөлшерде болған кезде және # x0221220 & # x0002f15 бастап & # синтезі 50 & # x00025 қысқартылды. Керісінше, проскрипт � G˼ тиімді бәсекелес болмады, ол эквимолярлық қатынаста болған кезде синтезді �⼕-тен 15%-ке ғана азайтты (Cурет ​ (Cурет ​). Б, жолақтар 9�). � G/U проскрипті �⼕ синтезін �⼓ (Cурет ​) арқылы байқалғаннан төмендетілген деңгейде (35%) тежеді. Б, жолақтар 14�). Бұл ингибирлеу деңгейі осы мутантты шаблонның синтезі азайған, бірақ жойылмаған нәтижеге сәйкес келеді (Cурет ​ (Cурет 2 2). Б, 2-жол). Бұл эксперименттің нәтижесі � позициясы және, ең алдымен, мутагенез арқылы анықталған басқа негізгі нуклеотидтер BMV RdRp арқылы байланысады деген идеяға сәйкес келеді.

(А) BMV субгеномдық промоторының мутациялық талдауының қысқаша мазмұны. WT тізбегі жоғарыда белгіленген салыстырмалы нуклеотидтердің позицияларымен көлденең көрсетілген қалың әріптермен. Промоторлар тізбегінің үстіндегі тіктөртбұрыштардағы пайыздар бастапқы үштік трансверсия мутанттарының салыстырмалы белсенділігін білдіреді. Нуклеотидтердің өзгеруінің кілті сол жақта. WT тізбегінің астында тізімделген мәндер WT проскриптімен салыстырғанда бір нуклеотидті мутанттардың пайыздық белсенділігін білдіреді. �, �, �, � позицияларындағы нуклеотидтерге қажетті болжамды функционалдық топтар көрсеткілердің астында көрсетілген. (Б) Субгеномдық негізгі промотор ішіндегі әлеуетті байланыстыру контактілері. 15-nt өнімінің синтезін басқаратын WT промоутері (�⼕) және 13-nt өнімді кодтайтын үш бәсекелес үлгінің бірі арасындағы бәсеке: �⼓, құрамында WT BMV субгеномдық промоутерquence𡈠⼒ x0002fC, функционалды емес мутант үлгісі � G/U, жартылай функционалды үлгі.1-жолдағы реакция ешбір кіріс үлгілерісіз орындалды, ал 2-жолдардағы реакциялардың әрқайсысы авторрадиографтың үстінде көрсетілген бәсекелес үлгісінің сәйкестігі мен санымен 25 нМ 'мамшалады. RdRp өнімдерінің сәйкестіктері және олардың өлшемдері авторрадиографтың әр жағында белгіленген.

Альфавирустық субгеномдық промоторлар.

BMV субгеномдық промоторын өсімдіктерді де, жануарларды да жұқтыратын альфавирус тәріздес суперфамилияның басқа мүшелерімен салыстыру BMV RdRp синтезі үшін маңызды төрт нуклеотидтің керемет сақталуын көрсетеді (Cурет ​ (Cурет 4). 4 А). Сонымен қатар, осы промоторлардың барлығында инициатор нуклеотид ретінде пиримидин (жануарлар вирустарында уридилат және өсімдік вирустарында цитидилат немесе уридилат) ʲ позициясында жоғары консервіленген аденилат бар. Бұл ұқсастық альфавирусқа ұқсас суперотбасы мүшелерінің RdRps сақталған механизм арқылы субгеномдық промоторларды танитынын білдіреді.

Альфавирусқа ұқсас суперфамилиядағы субгеномдық негізгі промоторларды сақтау. (А) Жануарлар мен өсімдік вирустарынан субгеномдық промоторларды теңестіру. Негізгі промотордағы сақталған нуклеотидтер қою шрифтпен көрсетілген. Тізбектер GenBank дерекқорынан алынды. Гомополимерлі жоғары ағын элементтері, егер бар болса, жақшалармен көрсетілген. SFV, Semliki Forest вирусы RRV, Ross River вирусы MBV, Middelburg вирусы SBV, Sindbis вирусы CMV, қияр мозаикалық вирусы AMV, жоңышқа мозаикалық вирусы BBMV, кең бұршақ вирусы CCMV, сиырдың хлоротикалық ала вирусы BMV, бром мозаика вирусы. Туралау clustalw бағдарламалық құралының көмегімен жасалды. Позициялар �, �, �, және � BMV тізбегінің астында ʱ инициациялық нуклеотидті білдіреді. (Б) BMV RdRp SFV субгеномдық промоторын таниды. BMV немесе SFV үшін WT субгеномдық промоторы бар проскрипттерге арналған схема көрсеткімен көрсетілген бастаушы нуклеотидпен көрсетілген. BMV проскриптінің 13 nt өнімі �⼓ 1-жолда көрсетілген. SFV проскрипті дұрыс іске қосу үшін аденилатты қажет ететін 11-nt өнімді кодтайды (2-жолақтар𠄵). RdRp реакциясында қолданылатын шаблон мөлшері (pmol) гельдің жоғарғы жағында көрсетілген 𢄪TP реакцияда АТФ жоқтығын көрсетеді. M T7 РНҚ полимеразасымен өндірілген 13 nt өлшемді маркерді білдіреді және φ қосымша шаблонсыз реакцияны білдіреді.

Үлгіні тану режимінің сақталу мүмкіндігін зерттеу үшін біз SFV (12, 13) субгеномдық промоторы бар проскриптті құрдық және оның BMV RdRp арқылы тану қабілетін сынадық (Cx200B (Cурет 4 4) Б). РНҚ өнімін BMV проскриптінен түзілген 13-нт өнімінен визуалды түрде ажыратуға болатындай, SFV прокрипті 11-нт өнімінің синтезіне арналған, оның алғашқы 9 нт WT SFV тізбегі, одан кейін екі гуанилат бар. RdRp өнімдерін [α- 32 PלTP-мен таңбалауға мүмкіндік беру үшін T7 РНҚ полимеразасымен қосылады. SFV проскрипті BMV RdRp-ге АТФ-ға тәуелді өнімді синтездеуге бағыттайды, тек осы шаблоннан субгеномдық синтез үшін бастамашы нуклеотид ретінде пайдаланылады (Cурет ​ (Cурет 4 4). Б, жолақтар 2𠄵). Синтез мөлшері WT �⼓ эквимолярлық мөлшерінен синтездің 0,25% ғана болды, бірақ фоннан айтарлықтай жоғары. Бұл нәтиже жануарды жұқтыратын вирустың субгеномдық промоторы бар РНҚ үлгісімен өсімдікті жұқтыратын вирустың RdRp арасындағы гетерологиялық өзара әрекеттесуді көрсетеді.


НӘТИЖЕЛЕР

Norovirus RdRps РНҚ-ны өздерінің субгеномдық негізгі промоторларынан арнайы синтездей алады

Біз RdRp норовирусы sgRNA вирустық РНҚ синтезі үшін негізгі промоторларды танитын репликаза кешенінің құрамдас бөлігі болып табылады деп болжадық. Рекомбинантты вирустық RdRps әдетте РНҚ синтезі үшін РНҚ үлгілерінің кең ауқымын пайдалана алады, сондықтан инициациялық нуклеотидтен басқа вирустық промотор элементтерін арнайы таниды деп есептелмеген (30,31). Бес РНҚ промоторы/үлгілері РНҚ синтезінің ерекшелігін зерттеуге арналған (сурет ​ (сурет 1А). 1A ). Үш РНҚ құрамында вирустық субгеномдық ядро ​​промоторлары болды, содан кейін қысқа үлгі тізбегі бар. Қысқаша айтқанда, бұл РНҚ ‘proscripts’ деп аталады. MNV, GII.4 адам норовирусы және Е гепатиті вирусының (HEV) проскриптері сәйкесінше Mps, Gps және Hps деп аталады (Сурет ​ (1А-сурет). 1A ). Қалған екі РНҚ, PE19 және PE46, промоторлар тізбегін қамтымайды, бірақ бұрын тиісінше: жаңадан С гепатиті RdRp (32) вирусымен басталған және праймерге тәуелді РНҚ синтезі.

Рекомбинантты норовирус RdRps олардың проскрипттерінен РНҚ синтезін бастауы мүмкін. (А) Рекомбинантты RdRps арқылы РНҚ синтезіне сыналған бес РНҚ-ның реттілігі мен болжамды РНҚ құрылымдары. РНҚ атаулары қою шрифтпен жазылған. Бар болған жағдайда үлгіні бастау қалдығының асты сызылады. Мутантты MpsIM және GpsIM — аденилатпен алмастырылған инициациялық цитидилаты бар Mps және Gps нұсқасы. Mps болжамды MNV CW1 изолятының қайталама құрылымы ( <"тип":"entrez-нуклеотид","attrs":<"text":"DQ285629","term_id":"82754799","term_text":"DQ285629"> > DQ285629), nt 5012 - 5059. Gps GII.4 изолятының реттілігі мен болжамды қайталама құрылымы Hu/GII.4/MD-2004/2004/US ( <"тип":"entrez-nucleotide","attrs" :<"text":"DQ658413","term_id":"110164874","term_text":"DQ658413">> DQ658413), nt 5044 - 5085. Hps болжамды HEV генотипінің қайталама құрылымы - 3 Керол C" type":"entrez-nucleotide","attrs":<"text":"JQ679013","term_id":"380083199","term_text":"JQ679013">> JQ679013), nt 5317 - 5361. (Б) РНҚ синтезі үшін қолданылатын РНҚ ерітіндіде бір басым конформацияда болады. Жоғарғы гель кескінінде 7,5 М мочевинамен түзетілген 15% полиакриламидті гельде бөлінген осы қолжазбадағы талдауда пайдаланылған РНҚ көрсетілген. Төменгі гель кескінінде несепнәр жетіспейтін 15% полиакриламидті гельде бөлінген РНҚ бар. РНҚ толуидин көкпен боялған. (C) GII.4 адам норовирусынан, MNV және HCV-ден RdRps жасаған РНҚ өнімдері. Өнімдер a жаңадан механизм және үлгінің 3-соңы жұлдызшалармен анықталғаннан кейін аяқталады. Гель кескіні құрамында 7,5 М мочевина бар 24% полиакриламидті гельдің Фосфоримагері арқылы алынды. Жаңадан басталған РНҚ ұзындықтары MNV RdRp өнімдері белгілі ұзындықтағы өнімдермен бірге электрофорезденген алдыңғы талдаулардан алынған. (D) алмастырулары бар проскриптер Т +1 цитидилаттар бағыттай алмайды жаңадан MNV және GII.4 RdRps арқылы РНҚ өнімдерін инициациялау. Праймер ұзарту өнімдері (PE) және жаңадан бастау (DN) көрсетіледі. Mps және Gps-тен дұрыс басталатын және аяқталатын РНҚ сәйкесінше 11- және 8-nt болып табылады.

MNV және GII.4 субгеномдық шаш қыстырғышының құрылымдары сақталған және MNV шаш қыстырғышындағы негізгі жұптасу тиімді MNV инфекциясы үшін қажет екендігі көрсетілген (24). Mfold компьютерлік бағдарламасы сонымен қатар проскрипт РНҚ контекстінде шаш қыстырғыш құрылымы термодинамикалық тұрғыдан ең тұрақты екенін көрсетеді (деректер көрсетілмеген). Дегенмен, MNV және GII.4 проскриптері ерітіндіде бір басым РНҚ құрылымын құрайтынын анықтау үшін денатурацияланатын және денатурланбайтын полиакриламидті гель электрофорезі арқылы РНҚ-ға талдау жасадық. Бұл талдау бұрын РНҚ-ның ЯМР спектроскопиясы үшін жарамдылығын сипаттау үшін қолданылған (33,34). Денатурациялаушы гельдерде барлық РНҚ күтілетін ұзындықтарына көшті (сурет ​ (1В-сурет). 1B ). Денатурацияланбайтын гельдерде РНҚ-лар да бір жолақ құрады, бұл Mps және Gps ерітіндідегі бір басым РНҚ құрылымын құрайды (сурет ​ (1В-сурет). 1B). Құрамында шаш қыстырғыш құрылымдары бар Mhp және Ghp РНҚ-лары ерітіндіде бір басым құрылымды құрады (сурет ​ (сурет 1B 1B).

MNV, GII.4 адам норовирусы және HCV жоғары тазартылған рекомбинантты RdRps олардың РНҚ синтезі үшін бес РНҚ пайдалану қабілеттеріне сыналған. Инфекция кезінде сгРНҚ синтезін бағыттайтын нуклеотидтерден РНҚ синтезін дәл бастау ұзындығы бойынша ерекшеленетін өнімдерді беруі керек. Mps, Gps және Hps сәйкесінше 11-nt, 8-nt және 24-nt РНҚ беруі керек. LE19P а синтезін басқарады жаңадан 19 nt өнімін бастады. Сондай-ақ оның құрамында праймер ұзартылуын блоктайтын 3 терминалдық пуромицин бар. PE46 тұрақты өзін-өзі күйдіретін РНҚ құрайды, оның 3 терминалы шамамен RdRps ұзартылуы мүмкін. 46-нт РНҚ өнімі (32).

Алдыңғы нәтижелерге сәйкес, HCV RdRp PE46-дан ұзындығы 46-нт және 19-нт болатын праймер ұзартқыш өнімдерін құрады. жаңадан- LE19P-ден басталған РНҚ (сурет ​ (1С-сурет). 1C ). HCV RdRp айтарлықтай мөлшерде шығарған жоқ жаңадан үш проскрипттің өнімдерін бастады. Оның орнына, жасалған өнімдер проскрипттерден ұзынырақ болды (сурет ​ (1C-сурет). 1C ). Бұл өнімдер проскрипттің бір тізбекті аймақтарымен жасытылған кездегі проскрипттердің 3 ұштары РНҚ-ның праймер кеңеюіне байланысты болуы мүмкін (сурет ​ (1С-сурет). 1C ). Осылайша, барлық бес РНҚ HCV RdRp арқылы РНҚ синтезінің қандай да бір түрін бағыттай алады, дегенмен HCV RdRp үш проскрипттің бастама үлгісінің нуклеотидтерін артық пайдаланбаған.

MNV RdRp шамамен негізгі өнімдерін шығарды. Mps-тен 50-, 11- және 10-nt. шамамен. 50-nt өнімі праймерді ұзарту арқылы пайда болуы мүмкін. Үлгідегі инициациялық цитидилаттан бастау алған 11 nt өнімі (атауы керек) Т + 1 цитидилат) және проскрипттегі шаблон тізбегінің соңында аяқталады. 10-нт өнімі дұрыстан шыққан болуы мүмкін жаңадан бастап бастама Т + 1 цитидилат, бірақ RdRp шаблон РНҚ-ның соңғы 3-нуклеотидіне жеткенше бір нуклеотид тоқтатылды. Бірнеше рекомбинантты RdRps үшін РНҚ синтезінің мерзімінен бұрын аяқталуы хабарланды in vitro (35,36). MNV RdRp РНҚ синтезін дәл бастай алатынын растау үшін Т + 1 цитидилат, біз проскрипт MpsIM қолдандық, оның тізбегіндегі аденилат алмастыруын қоспағанда, Mps реттілігі бірдей. Т + 1 позиция. MpsIM 11 немесе 10 nt өнімнің синтезін басқармады, бірақ кіріс үлгісінен ұзағырақ праймер кеңейтім өнімдерін жасады (сурет ​ (сурет 1D). 1D ). Бұл нәтиже MNV RdRp Mps-тен РНҚ синтезін дәл бастай алатынын көрсетеді. Бір қызығы, бірнеше сынақтарда праймермен кеңейтілген өнім Mps-ке қарағанда MpsIM-те көбірек болды, бұл оның болмауын болжайды. жаңадан басталған РНҚ синтезі RdRp-ге праймерге тәуелді РНҚ синтезіне қатысуға мүмкіндік берді.

MNV RdRp 8-nt-тың аз ғана көптігін өндірді жаңадан GII.4 proscript, Gps бастап өнім. Дұрыс іске қосылған, бірақ үлгідегі 3-ден 1-н-ға қысқа мерзімде аяқталатын 7-nt өнімі де шығарылды (сурет ​ (1C-сурет). 1C ). Hps көмегімен тек праймер кеңейтілген өнімдер байқалды. PE46 көмегімен MNV RdRp тек праймермен кеңейтілген өнімдерді шығарды, ал LE19P РНҚ синтезін бағыттамады (сурет ​ (1C сурет). 1C ). Жалпы алғанда, бұл нәтижелер MNV RdRp РНҚ синтезін бағыттау үшін өзінің жеке проскрипті пайдаланғанын көрсетеді.

GII.4 RdRp де дәл көрсетті жаңадан өзінің проскриптінен бастау in vitro (Сурет ​ (сурет 1C). 1C ). GpsIM деп аталатын Gps инициациялық цитилатында орынбасуы бар РНҚ өндіре алмады. жаңадан басталған РНҚ (сурет ​ (1D-сурет). 1D ). MNV проскрипті де бағыттай алмады жаңадан кейбір праймер-кеңейту өнімдері жасалғанымен, РНҚ өнімдерін бастады. MNV RdRp сияқты, GII.4 RdRp де Hps, PE46 және LE19P өнімдерінің аз мөлшерін өндірді. MNV RdRp сияқты, GII.4 RdRp РНҚ синтезі үшін өзінің туыстық проскрипті РНҚ-ға қатты артықшылық береді.

MNV RdRp арқылы тануға ықпал ететін Mps элементтері

MNV RdRp оның проскриптіне жақындығын анықтау. Mps синтезделді, оның 5 ұшында фторфор бар, нәтижесінде РНҚ fMps пайда болды. fMps бағытталған өнім синтезі MNV RdRp арқылы Mps-тен айырмашылығы жоқ (деректер көрсетілмеген). Флуоресцентті поляризация талдаулары бір торапты байланыстыру моделіне орнатылған байланыстыру изотермаларын жасады. MNV RdRp болды Қг fMps үшін 0,5 және 1 μM (сурет ​ (2B 2B-сурет).

MNV субгеномдық проскриптіндегі шаш қыстырғышы RdRp арқылы байланысу және РНҚ синтезін бағыттау үшін қажет. (А) Бұл талдауда РНҚ қолданылады. РНҚ атаулары қою шрифтпен жазылған. ΔSL1 және ΔSL2 Mps шаш қыстырғышында жоюлар бар, бірақ үлгі реті өзгеріссіз. Цитидилат инициациясының шаблоны қою әріппен және асты сызылған. (Б) fMps үшін MNV RdRp жақындығын бағалайтын флуоресценция поляризациясының нәтижелері. РНҚ fMps химиялық жолмен синтезделді, ол Mps-ке қосылған 5'6-карбоксифлуоресцеинді (6-FAM) қамтиды. Байланыстыру изотермасы көрсетілген және барлық деректер нүктелері үш данада бағаланған. Нәтижелер төрт тәуелсіз талдау арқылы қайталанады. (C) MNV RdRp fMps байланыстыруында Mps және Mhp тежеу ​​қызметін бағалайтын бәсекелестік талдау. Тиімді ингибиторлық концентрация (IC50) және бәсекелес РНҚ, Mps және Mhp үшін төбенің еңісі графиктің үстінде көрсетілген. МЕН ТҮСІНЕМІН50 мәндер Николовска-Колеска әзірлеген алгоритм арқылы шығарылды ж.тਊl. (61). (D) Mps және Gps ішіндегі шаш қыстырғышы MNV RdRp-ге байланыстыра алады. График үш бәсекелес РНҚ, Chp, Ghp және Mhp концентрациясының жоғарылауы жағдайында MNV RdRp көмегімен орындалған РНҚ синтезі талдауының нәтижелерін көрсетеді. Салыстырмалы нәтижелер үш тәуелсіз экспериментте алынды. (Е) Mps шегіндегі шаш қыстырғышындағы жоюлар айтарлықтай төмендеді жаңадан РНҚ синтезін бастады. Гель кескіні РНҚ синтезі талдауынан алынған, шаблон РНҚ-лары барлығы 0,05 ₮-де. (Ф) GII.4 norovirus RdRp GII.4 norovirus прокриптіндегі шаш қыстырғышын арнайы тани алады. График үш бәсекелес РНҚ, Chp, Ghp және Mhp концентрацияларының жоғарылауы жағдайында MNV RdRp көмегімен орындалған РНҚ синтезі талдауының нәтижелерін көрсетеді.

Біз Mps ішіндегі шаш қыстырғышы Mps Mps тұрақты байланысын қамтамасыз ететінін анықтауға тырыстық. MNV RdRp көмегімен алдын ала инкубацияланған fMps Мп немесе М/с концентрациясының жоғарылауымен сынға ұшырады (​ (сурет 2A). 2A ). Алынған флуоресценттік поляризация деректері РНҚ концентрациясына қарсы сызылған және деректер IC мәндерін беретін Хилл теңдеуіне орнатылған.50 Mps және Mhp үшін тиісінше 2,36 және 16,2 μM (сурет ​ (2C-сурет). 2C ). The Қмен осы IC бойынша есептелген мәндер50 мәндер Mps үшін 0,68 μM және Mhp үшін 6,3 μM болды. Бұл нәтижелер Mps шаш қыстырғыш бөлігі MNV RdRp байланыстырса, үлгі тізбегі тұрақты байланыстыруға ықпал ететінін көрсетеді.

Әрі қарай біз MNV RdRp арқылы РНҚ синтезі үшін Mps-тегі шаш қыстырғышының қажет екенін бағаладық. MNV RdRp және Mps көмегімен бағдарламаланған РНҚ синтезі реакцияларына MPh, Gph (GII.4 проскриптінің шаш қыстырғышы) немесе Chp (Чикунгунья вирусының прокрипті шаш қыстырғышы) концентрациясының жоғарылауымен шағым жасалды (​ (Сурет 2A) 2A). Mps РНҚ синтезіне Chp қосылуы әсер еткен жоқ (сурет ​ (2С-сурет). 2C ). Дегенмен, Ghp және Mhp екеуі де РНҚ синтезінің тиімді ингибиторлары болды. Бұл нәтижелер MNV RdRp норовирусты субгеномдық шаш қыстырғышын жақсы танитынын көрсетеді, бірақ ол қолданылған жағдайларда Mhp және Ghp арасын ажырата алмады. in vitro (сурет ​ (2D 2D суреті).

MNV RdRp арқылы тануға Mps-тегі шаш қыстырғышының үлесін қосымша анықтау үшін ΔSL1 және ΔSL2 деп аталатын Mps шаш қыстырғышының бөліктері жойылған РНҚ-лар сыналған (сурет ​ (2А-сурет). 2A ). Екеуі де РНҚ синтезі үшін инициация тізбегін сақтап қалды in vitro, бірақ ешқайсысы бағыттай алмады жаңадан РНҚ синтезін бастады (сурет ​ (2E-сурет). 2E ). ΔSL1 және ΔSL1 праймер-кеңейту өнімдерінің мөлшері де Mps-ге қатысты күрт төмендеді, бұл шаш қыстырғыш құрылымы және/немесе реттілік MNV RdRp арқылы тану үшін қажет дегенді білдіреді (​ (сурет ​ (2E сурет). 2E). РНҚ тиімді синтезі үшін Mps ішіндегі шаблон да, шаш қыстырғыш құрылымы да қажет.

GII.4 RdRp арқылы РНҚ синтезі бәсекелес шаш қыстырғыш РНҚ концентрациясының жоғарылауы жағдайында да тексерілді. Ghp концентрацияға тәуелді түрде proscript Gps-тен GII.4 RdRp арқылы РНҚ синтезін тежеді (сурет ​ (2F-сурет). 2F ). Атап айтқанда, тежелу дәрежесі MNV RdRp тежеуіне ұқсас болды. Бір қызығы, Mhp және Chp екеуі де Gps-тен GII.4 RdRp арқылы РНҚ синтезінің нашар тежегіштері болды. Бұл GII.4 RdRp өзінің туыстық субгеномдық шаш қыстырғышы үшін MNV RdRp қарағанда GII.4 проскриптіндегі шаш қыстырғышы үшін жоғары ерекшелікке ие екенін көрсетеді. Gps шаш қысқышы үшін GII.4 RdRp бойынша бұл жоғары ерекшелік оның төмендеуіне байланысты болуы мүмкін жаңадан Mps РНҚ өнімдерін бастады (сурет ​ (сурет 1B 1B ).

Вирустық РНҚ синтезіндегі инициация тізбегінің рөлі

Вирустық репликалар да, ДНҚ-ға тәуелді РНҚ-полимеразалар да инициациялық нуклеотидті (36�) қамтитын нуклеотидтерді таниды. Прокрипттердегі бір тізбекті реттілік RdRps норовирусы басқаратын РНҚ синтезіне ықпал ететінін анықтау үшін Mps және Gps шаш қыстырғыштарын ауыстыратын екі химерикалық РНҚ жасалды және олардың жұмыс істеу қабілетіне сынақтан өтті. in vitro (Сурет ​ (3A-сурет). 3A ). MNV проскриптінен шаш қыстырғышы және GII.4 проскриптінен бір тізбекті тізбегі бар Химер 1 (C1) РНҚ дұрыс ұзындығы мен концентрациясы болғанына қарамастан, HCV, GII.4 және MNV RdRps арқылы РНҚ синтезін басқаруда нашар болды ( ​ суреті (3B-сурет).3B ). РНҚ бүктеу бағдарламалары C1 күтілетін шаш қыстырғышын және бір тізбекті тізбекті құрайтынын болжады (деректер көрсетілмеген). Дегенмен, нашар синтезді ескере отырып, C1 РНҚ нәтижелерін интерпретациялау ең аз болуы керек.

Mps және Gps бір тізбекті РНҚ тізбегі норовирустық РНҚ-тәуелді РНҚ синтезіне әсер етеді. (А) Химерлік РНҚ схемалары осы талдауда зерттеледі. Қорап шаш қыстырғыш құрылымын білдіреді, ал бір тізбекті РНҚ тізбегі толығымен көрсетілген. (Б) Химиялық жолмен синтезделген С1 және С2 РНҚ және GpsIM гельдік кескіні. РНҚ 7,5 М мочевинамен түзетілген 24% полиакриламидті гельде шешілді. РНҚ метилен көгімен бояу арқылы көрінді. (C) С1 және С2 РНҚ-ларынан, сондай-ақ бақылаулардан алынған рекомбинантты вирустық RdRps арқылы РНҚ өнімдері. Гельдік кескінде вирустық РНҚ синтезі талдауының өнімдері бар. Ұзындықтары жаңадан инициация өнімдері гельдік кескіннің сол жағында анықталады.Дұрыс жаңадан MNV үлгілер тізбегінен басталған және тоқтатылған өнімдер M белгісімен таңбаланады. Дұрыс жаңадан GII.4 шаблон тізбегінен басталған және аяқталған өнімдер G белгісімен таңбаланады. Синтезделген РНҚ мөлшері сандық түрде анықталады, жабайы типтегі проскриптке қалыпқа келтіріледі және гель кескінінің астында көрсетіледі. GII.4 және MNV RdRps өнімдері оның гомологтық проскриптінен (астын сызылған 100 ретінде белгіленеді) RdRp шығаратын мөлшерлерге нормаланады.

MNV бір жіпті тізбегі және GII.4-тен шаш қыстырғышы бар Chimera 2 (C2) GII.4 RdRp-ді 20% өндіруге бағыттады. жаңадан Gps-пен салыстырғанда бастапқы өнім. Бұл GII.4 RdRp өзінің бір тізбекті тізбегін қатты таңдайтынын көрсетеді. GII.4 RdRp да көбірек өндірді жаңадан С2-ден РНҚ-ны Mps (20 және 8-ге қарсы 3C-сурет), 3C салыстырғанда, туысқан шаш қыстырғышы ықпал ете алады деген идеяға сәйкес келеді. де қарашаo басталған РНҚ синтезі.

MNV RdRp көмегімен C2 Mps сомасына қатысты өнімнің тек 17%-ын бағыттады. Mps және C2 бірдей бір тізбекті тізбегі бар екенін ескере отырып, РНҚ синтезінің төмендетілген деңгейі MNV Sg шаш қыстырғышының тиімді РНҚ синтезі үшін қажет екенін көрсетеді (сурет ​ (сурет 2D 2D және ​ және Е). E). C2 MNV RdRp-ді осындай көлемде шығаруға бағыттады жаңадан Gps-пен салыстырғанда инициативті РНҚ (17-15-сурет ​ сурет 3C). 3С). C2 және Gps бірдей шаш қыстырғыш тізбегін бөлісетінін, бірақ олардың бір тізбекті тізбегінде ерекшеленетінін ескере отырып, MNV RdRp GII.4 RdRp-ге қарағанда бір тізбекті ретті тануға икемді болады. Осылайша, MNV RdRp өзінің жеке субгеномдық проскриптті танитынына қарамастан, GII.4 RdRp-пен салыстырғанда шаш қыстырғышы үшін де, бір тізбекті РНҚ тізбегі үшін де төмен спецификалық болады. Бұл төмен ерекшелік, мүмкін, MNV RdRp арқылы Gps-тен азғын РНҚ синтезінің жоғары деңгейіне жауап береді.

Субгеномдық проскриптпен байланысатын MNV RdRp аймақтарын анықтау

Біз RdRp норовирусындағы субгеномдық проскриптпен байланысатын нақты аминқышқылдарын анықтауға тырыстық. MNV жүйесі адамның норовирусына қарағанда генетикалық манипуляция үшін үлкен икемділікті қамтамасыз ететінін ескере отырып, біз оның проскрипті үшін төмендетілген ерекшелігіне қарамастан, MNV RdRp картасына түсіру әрекетін шоғырландырдық. Карталау зерттеулерінде вирустық РНҚ-мен айқаспалы байланыс жасай алатын RdRp ішіндегі пептидтік тізбектерді анықтау үшін қайтымды айқаспалы байланыс пен пептидтік массалық саусақ іздерін біріктіретін RCAP протоколы пайдаланылды (сурет ​ (4А-сурет). 4A ). Қысқаша айтқанда, РНҚ және RdRp формальдегидпен қиылысады, содан кейін трипсинмен кешеннің кең қорытылуы болды. РНҚ-мен байланысты РНҚ және пептидтер LiCl-мен тұндырылды және қыздыру арқылы айқаспалы байланыстар жойылды. Содан кейін MALDI-ToF/MS РНҚ-ассоциацияланған пептидтерді анықтау үшін пайдаланылды. РНҚ жоқ кезде формальдегидпен өңделген MNV RdRp немесе формальдегидпен айқаспаған RdRp-РНҚ кешені бар бақылау реакциялары фоннан жоғары сигналдарды бермеді. Дегенмен, MNV RdRp алынған 17 пептидтер Mps, ал 11 пептидтер Mhp-мен байланысты екені анықталды (сурет ​ (сурет 4B 4B және қосымша S1 сурет). Әрбір деректер жинағында бірнеше пептидтердің өткізіп алған бөлінулеріне байланысты қабаттасатын тізбегі болды. трипсин, ол аргинин немесе лизин қалдығы РНҚ-мен айқаспалы байланысқан кезде пайда болады. Mps-пен байланысатыны анықталған 17 MNV RdRp пептидтерінің сегізі ғана RdRp-дегі бірегей аймақтарды білдіреді. Сонымен қатар, байланыстырылған деп анықталған барлық пептидтер. Mhp бар MNV RdRp және Mps арқылы орындалған реакцияларда да болды. Mps құрамында миль болатын шаш қыстырғышы бар екенін ескере отырып, күту керек. Осы пептидтердің орналасуын визуализациялау үшін біз бұл пептидтерді MNV-1 RdRp кристалдық құрылымында салыстырдық. (PDB: 3QID) (39) (​-сурет (4С-сурет). 4C ).Айқас байланысқан пептидтердің көпшілігі РНҚ синтезі жүретін MNV RdRp орталық қуысында орналасқан.

Mps және Mhp байланысатын MNV RdRp аймақтары. (А) RdRp-РНҚ контактілерін салыстыру үшін пайдаланылатын RCAP протоколының схемасы. (Б) MALDI-ToF Mps немесе Mhp байланысқан MNV RdRp пептидтерін анықтады. Mps және Mhp байланысқан пептидтер сәйкесінше ‘Mps’ және ‘Mph’ белгіленген бағандарда. Плюс (+) таңбасы пептидтің байқалғанын көрсетеді. (−) белгісі пептидтің байқалмағанын көрсетеді. Пептидтердің тізбегі стандартты бір әріпті аминқышқылдарының кодтарында берілген және пептидтер тізбектердегі қабаттасуларды көрсету үшін тураланған. (C) Mps (қызыл) немесе Mhp (көк) немесе тек Mps (қызыл) байланысқан MNV RdRp аймақтары. MNV RdRp құрылымы PDB 3QID-тен алынған және модель Chimera (UC San Francisco) бағдарламалық жасақтамасымен жасалған. MNV RdRp-дегі A, C, E және F RdRp мотивтерінің шамамен орындары көк түспен белгіленген.

Mps және Mhp-мен байланысты пептидтер MNV RdRp (сурет ​ (4C-сурет 4C жоғарғы және ортаңғы панельдер)) сақталған мотивтердің жанында орналасқан. РНҚ-мен және субстрат нуклеотидпен әрекеттесетіні белгілі (40,41) 240� қалдықтары бар пептидтер А мотивімен қабаттасады, құрамында NTP-ді байланыстыруға және фосфодиэфир байланысының түзілуін катализдейтін екі валентті металл иондарын үйлестіретін аспартаттар бар (40,441) Құрамында 397� қалдықтары бар пептидтер саусақтар мен пальма субдомендерін байланыстыратын Motif E жанында болды және платформаның бір бөлігі ретінде ұсынылды. жаңадан бастау (42�).

Mps-пен байланысты, бірақ Mhp емес алты MNV RdRp пептидтері Mps-дегі бір тізбекті тізбегімен байланысуы мүмкін (сурет ​ (сурет 4C 4C төменгі). Аминоқышқылдарының қалдықтары 177� F мотивімен және 220� қалдықтарымен іргелес. x02013276 А мотивінің жанында. 385� қалдықтары қабаттастырылған E мотиві болып табылады, ол субгеномдық шаш қыстырғыштың түйісуімен де, бір тізбекті тізбекпен де байланысатын MNV RdRp орнын көрсетуі мүмкін.

Негізгі промотор шаш қыстырғышымен байланысатын MNV RdRp қалдықтарын анықтау

Субгеномдық шаш қыстырғышымен байланысатын MNV RdRp пептидтерінің идентификациясын растау үшін біз 4-тио-урацил (4SU) аналогтары мен амин қышқылдары (45) арасында жоғары тиімді фотоактивтелетін айқаспалы байланысты қолдандық. Mhp үш нұсқасы химиялық жолмен синтезделді, олардың әрқайсысында 2, 15 немесе 24 қалдықтарында 4SU бар, сәйкесінше 2-4SU, 15-4SU және 24-4SU деп аталатын РНҚ түзілді (сурет ​ (5А-сурет). 5A ). In vitro РНҚ синтезінің талдаулары үш РНҚ Mps-тен РНҚ синтезін өзгертілмеген Mhp деңгейіне дейін тежейтінін растады (Қосымша сурет S2). MNV RdRp және трипсинді ыдыратудан кейін, пептид-РНҚ кешендері LiCl-мен тұнбаға түсті. Содан кейін комплекстердегі РНҚ мұқият қорытылып, пептидтерден нуклеотидтерді босатып, тек айқаспалы нуклеотид қалдырды. Содан кейін LTQ-Orbitrap құралын пайдаланып, жоғары ажыратымдылықтағы және соқтығысты диссоциациялану (CID) массалық спектрлері арқылы айқаспалы пептидтердің сәйкестіктері анықталды. Крамер ж.тਊl. Белоктардың және 4SU алмастырылған РНҚ-ның айқаспалы байланысуы H2S, 4SU-дағы қос байланыстың жоғалуы және 3′ немесе 5′ позицияларының бірінен немесе екеуінен де фосфаттардың жоғалуы (45). Осы құрылымдық мүмкіндіктердің барлығы MNV RdRp протеині мен модификацияланған РНҚ арасындағы қиылысу реакциялары үшін Orbitrap масс-спектрлерін талдау кезінде қарастырылды. RdRp-тің модификацияланған РНҚ-мен реакцияларынан аргинин немесе лизин қалдықтарына қосылған бір немесе бірнеше 4SU молекуласы бар үш түрлі пептидтер анықталды. 409� қалдықтарынан алынған LD R ASID R QLLWTK тізбегі 15-4SU байланыстыру үшін сенімді түрде анықталды (сурет ​ (5В-сурет). 5B ). CID деректері 15-4SU R411 және R416 бүйірлік тізбектерімен айқасатынын және оның күкірт атомының №5C суретінде көрсетілгендей жоғалуына әкелетінін көрсетті. 5С. Қосымша екі пептид K R LLWGSDLGTMIR (қалдықтар 184� айқаспалы аргинин асты сызылған) және WDSTQQ R AIL K (қалдықтар 249�, айқас байланысқан аргинин және лизин асты сызылған) (С-24SU және байланыстырылған сурет) анықталды. Дегенмен, екі пептид үшін де кейбір сигналдар 2-SU және 24-4SU-да байқалды, бұл шаш қыстырғышындағы дөңес аймақ пен шаш қыстырғышының РНҚ негізі екі түрлі жерде RdRp-мен байланыса алатынын көрсетеді. Мұнда анықталған үш 4SU кросс-байланыстырылған пептидтер де бұрын талқыланған RCAP талдауында анықталған (сурет ​ (4-сурет). 4 ). Бір-бірімен байланысқан бес қалдықтың орындары ​ Сурет5D 5D суретіндегі MNV RdRp үлгісінде көрсетілген.

Mhp ішіндегі 4-тиуридилатпен (4SU) байланысатын MNV RdRp қалдықтары. (А) Химиялық жолмен синтезделген Mhp РНҚ ішіндегі 4-SU орналасуы. 4-SU қалдығының әрқайсысы бар РНҚ атаулары қою шрифтпен жазылған. Барлық үлгілер тек пептидтерге ковалентті 4-SU нуклеотидін қалдыруы керек РНҚ-ның толық қорытылуын қамтитын ультракүлгін айқаспалы байланыстыру протоколымен өңделді. (Б) Пептид ионының [LDR(4SU)ASIDR(4SU)QLLWTK- S массалық спектрі (MS) және соқтығысты диссоциация (CID) спектрі2] 4+ Thermo LTQ-Orbitrap құралында алынған. (Жоғарғы) LDR(4SU)ASIDR(4SU)QLLWTK- S пептидтік ионының жоғары ажыратымдылықтағы массалық спектрі (MS)2] 4+ (RdRp қалдығы 409�) 15-2SU алмастырылған РНҚ-мен реакциядан. Өлшенген моноизотоптық масса (5 ppm массалық қате) -де м/з 543,5358 (4+). (Төменгі жағында) осы пептид ионының CID спектрі м/з 543.5. CID фрагментінің ион тағайындаулары (C) құрылымындағы үзік сызықтармен суреттелген. (C) Екі есе алмастырылған 4SU пептидінің ұсынылған құрылымы және соқтығысты индукцияланған диссоциация (CID) фрагменттері (үзік сызықтар). Бөлшектену кезіндегі ең көп таралған жоғалту рибоза қантының жоғалуы (м/з 133) негізгі ионнан немесе оның пептидтік фрагменттерінен. (D) 4-SU-модификацияланған үш РНҚ-мен байланысу үшін анықталған MNV RdRp-дегі қалдықтардың орындарының қысқаша мазмұны. Қалдықтардың бүйірлік тізбектері қызыл түспен көрсетілген. (Е) Mhp түрлі аймақтарымен байланысқан MNV RdRp табылған қалдықтарға қатысты норовирус RdRps тізбектерінің туралануы. Барлық тізбектер олардың Genbank қосылу нөмірімен көрсетіледі. Вирустық RdRps сақталған арнайы мотивтердегі қалдықтардың асты сызылған. 4SU-модификацияланған MNV-мен байланысу үшін анықталған қалдықтар, басқа норовирустық RdRps-тегі салыстырмалы қалдықтар сияқты қызыл түсті. Негізгі қалдықтарда аминқышқылдарының алмастырулары бар жерлерде өзгерістер көк түспен көрсетіледі.

MNV RdRp-дегі субгеномдық промотор шаш қыстырғышының контактілерінің функционалдық сипаттамасы

Mhp-мен байланысатын осы қалдықтардың функционалдық сәйкестігін бағалау үшін біз олардың бірнеше норовирустардан RdRps-те реттілігінің сақталу дәрежесін зерттедік. R185, R255 және R416 қалдықтары норовирустар арасында жоғары деңгейде сақталған, ал K259 және R411 тек тышқан норовирустарында сақталған (сурет ​ (5E-сурет). 5E ). Біз жоғары консервацияланған қалдықтар РНҚ синтезі үшін маңыздырақ, ал аз сақталған аминқышқылдары РНҚ-ны түрге тән тануға көбірек қатысады деп ойладық.

Болжалды РНҚ өзара әрекеттесетін қалдықтардың RdRp белсенділігіне әсер ететінін анықтау үшін осы қалдықтарда алмастырулары бар рекомбинантты ақуыздар Mps көмегімен РНҚ синтезіне сыналған (сурет ​ (6А-сурет). 6A). Жоғары сақталған R185 және R255-те аланин алмастырулары бар MNV RdRps РНҚ айтарлықтай төмендегенін көрсетеді. жаңадан РНҚ синтезін бастады және үлгі ретінде Mps пайдалана отырып, праймер өнімінің бір бөлігін ғана өндірді (суреттер ​ (сурет 4 4 және ​ және 6B, 6B, ​,C). C). Аз сақталған K259-де алмастыру бар мутант RdRp екеуінде де айқын ақау болған жоқ. жаңадан РНҚ синтезін немесе праймерді кеңейтуді бастады (сурет ​ (44-сурет).

РНҚ синтезі үшін MNV RdRp мутацияларының әсерінің функционалдық сипаттамасы, Mps және олардың термоденатурация профильдерімен байланысуы. (А) Талдауда қолданылатын тазартылған рекомбинантты ақуыздар. Кескін Coomassie көгімен боялған SDS-PAGE. Молекулалық салмақ маркері (M) Пирстен алынған. R411AR416A рекомбинантты RdRp құрамында R411 және R416 екеуінде аланин алмастырулары бар екенін білдіреді. (Б) WT және мутант MNV RdRps арқылы синтезделген РНҚ. WT немесе мутацияланған RdRps концентрациясы әр реакцияда 250 нМ және Mps 50 нМ болады. Праймер ұзарту өнімдері (PE) және жаңадан бастау (DN) көрсетіледі. DN өнімдерінің ұзындығы 11- және 10-нт. WT мөлшеріне қалыпқа келтірілген РНҚ мөлшері сандық түрде анықталып, гельдік кескіннің астында көрсетілген. (C) WT және мутант MNV RdRps арқылы синтезделген РНҚ. WT немесе мутантты RdRps концентрациясы 1 μM және Mps әрбір реакцияда 50 нМ болады. (D) Үлгі Mps концентрациясының ұлғаюы сомасын қалпына келтіре алды жаңадан-R411A RdRp арқылы РНҚ синтезін бастады (жоғарғы график). Бір қызығы, праймерді ұзарту өнімдерінің салыстырмалы мөлшері R411A мутантына түзетілмеді. (Е) WT, R411 және R416 RdRps бойынша Mps үшін байланыстыру изотермалары. Байланыстыру изотермаларынан алынған диссоциация константалары WT MNV, R411A және R416A мутанттары үшін 0,5, 1,4 және 1,7 ≥cM. Деректер 6-FAM таңбаланған Mps және рекомбинантты RdRps көмегімен орындалған флуоресцентті поляризация талдауларынан алынған. (Ф) WT, R411A, R416A және R411AR416A RdRps термоденатурациясы профилі. Жоғарғы панельде WT MNV RdRp термоденатурация профильдерін R411A, R416A, R411AR416A мутанттарымен салыстыру көрсетілген. R411A RdRp бар Ткарта WT RdRp R416A мутациясынан 2°C төмен. Ткарта WT RdRp R411AR416A қарағанда 1ଌ жоғары. Ткарта WT RdRp сияқты. (Г) WT RdRp термоденатурациялық профильдері Mps жоқ және бар. (Х) R411A RdRp термоденатуратациялық профильдері Мпссіз және бар. Талдау RdRp-тің РНҚ-ға 1:2 молярлық қатынасымен орындалды.

R411 және R416 қалдықтарындағы алмастырулар РНҚ синтезіне күрделірек әсер етті. R411 тек MNV-де сақталады және E мотивінің жанында орналасқан. Лизинмен немесе аланинмен алмастырылғанда, нәтижесінде алынған ақуыздар, R411K және R411A, 𢏅 есе аз өндіріледі. жаңадан инициациялық РНҚ өнімі WT MNV RdRp (сурет ​ (6В-сурет). 6B ). Бір қызығы, R411K немесе R411A жасаған праймерді ұзарту өнімдерінің көптігі жабайы типтегі MNV RdRp шығаратын өнімдермен салыстырмалы немесе сәл жоғары болды. R416A мутанты праймерді ұзарту үшін де, айтарлықтай төмендетілді жаңадан бастау (сурет ​ (6В-сурет). 6B ). WT немесе мутацияланған RdRps концентрациясы жоғарылағанда, R411A қалпына келтірді жаңадан бастау белсенділігі WT RdRp деңгейіне ұқсас. Мутант R416A жоғары концентрацияларда сыналған кезде көбірек өнім шығарды, бірақ праймер ұзартқышы да және жаңадан WT RdRp-пен салыстырғанда инициация күрт төмендеді. Бір таңқаларлығы, екі негізгіден жаңадан R416A жасаған РНҚ өнімдері, 1-nt арқылы мерзімінен бұрын тоқтатылған өнім толық ұзындықтағы өнімге қарағанда көбірек болды (сурет ​ (6C-сурет). 6C ). Үлгі-жаңа РНҚ дуплексін тануға әсер ететін рекомбинантты RdRps бұрын мерзімінен бұрын тоқтатуды арттыратыны көрсетілген (46). R411A, R416A немесе R411 және R416 екеуінде де алмастырулары бар мутант арқылы синтезделген РНҚ сандық көрсеткіштері 6D суретте көрсетілген. 6D. Бұл нәтижелер MNV субгеномдық шаш қыстырғышымен байланысатын R411 және R416 әсер ететінін көрсетеді жаңадан РНҚ синтезін бастады және промоторлар тізбегін нақты тануға мүмкіндік береді.

R411 және R416 қалдықтары MNV RdRp субгеномдық проскриптпен байланысуына ықпал етеді.

R411A және R416A арқылы fMps байланысуы үшін диссоциация константасын анықтау үшін флуоресценциялық поляризация талдауы қолданылды. R411A мутанты қарапайым болды. WT RdRp салыстырғанда Mps үшін диссоциация константасының 3 есе төмендеуі. R416A мутантының Mps-пен байланысуы R411A деңгейіне ұқсас деңгейде аз ғана әсер етті (сурет ​ (6E-сурет). 6E ). Бұл нәтижелер РНҚ синтезі талдауларының нәтижелерін толықтырады және MNV RdRp құрамындағы R411 және R416 қалдықтарының Mps-пен әрекеттесетінін растайды.

R411A және R416A көрсеткен РНҚ байланысуының байқалған ақауы проскриптті байланыстыру үшін қажет RdRp конформациясының өзгеруіне немесе проскрипттің жақындығына әсер етуі мүмкін. RdRp конформациясына әсер еткенін тексеру үшін біз WT және мутант RdRps термоденатурация профилін өлшеу үшін дифференциалды сканерлеу флюориметриясын (DSF) қолдандық. Бұл талдау SYPRO қызғылт сары бояғышының температураға байланысты көбірек әсер ететін белоктардың гидрофобты аймақтарымен байланысуын өлшейді (47). Байланыстырылған SYPRO апельсині аминқышқылдарының алмастырылуы және/немесе лигандтармен байланысуы әсер еткендей, ақуыздың бөлінуі туралы хабарлау үшін флуоресцентті болады. WT MNV RdRp айқын болды Тм (ТКарта) 43,5ଌ. R411A болды ТКарта шамамен WT және R416A мутантынан 2°C төмен ТКарта бұл WT деңгейінен 1ଌ жоғары болды. Осылайша, екі алмастыру да RdRp конформациясына шаблонды байланыстырудан бұрын әсер етті.

Mps-тің WT және мутант RdRps термоденатурациялық профильдеріне әсері де зерттелді. Алайда, ешқандай өзгеріс байқалмады ТКарта WT RdRp немесе мутанттармен. Mps протеиндердің жалпы флуоресценциясын төмендетті, бірақ WT RdRp және мутанттар үшін бірдей әсер байқалды (сурет ​ (сурет 6G 6G және ​ және H H және деректер көрсетілмеген). Сондай-ақ шамалы өзгеріс болды. R411A-мен шамамен 55°C флуоресценция, оның маңыздылығы әлі белгісіз (сурет ​ (сурет 6H 6H ).

MNV RdRp R411-мен салыстырылатын GII.4 RdRp қалдықтарының модификациясы Mps көмегімен РНҚ синтезін аздап арттырды.

Біз ​ сурет 1B, 1B суретінде көрсеткеніміздей, GII.4 RdRp тек төмен деңгейлерге бағытталған. жаңадан Mps РНҚ синтезі. Бұдан басқа, RdRp реттілігі GII.4 RdRp-де 408-позицияда глутамин және 256-позицияда аланин бар екенін көрсетеді, бұл MNV RdRp-тің R411 және K259-мен салыстырылады (​ (сурет 5E). 5E ). Бұл бақылаулар бізге GII.4 RdRp алмастырулары Q408R, A256K немесе екеуі де жақсара алатынын анықтауға әкелді. жаңадан Гетерологиялық MNV прокрипті бар РНҚ синтезі. Барлық үш мутант RdRps WT GII.4-пен салыстырғанда Gps-тен салыстырмалы өнім көлемін өндірді, бұл олардың туыстық проскрипті үшін ерекшелік жоғалмағанын көрсетеді (сурет ​ (сурет 7A 7A және ​ және В). B ). WT MNV RdRp салыстырғанда, мутанттар әлдеқайда төмен деңгейлерді бағыттады жаңадан Mps-тен 11-нт РНҚ инициациясы.Дегенмен, Q408R және Q408R/A256K мутантты ақуыздарымен WT GII.4 RdRp салыстырғанда шамамен 2 есе жоғарылау байқалды (сурет ​ (7C-сурет). 7C ). РНҚ синтезінің жоғарылауы қарапайым болғанымен, нәтижелер үш тәуелсіз талдауда қайталануы мүмкін. Бұл нәтижелер MNV RdRp құрамындағы R411 қалдығы бағыттау үшін маңызды екенін көрсететін алдыңғы деректерді қолдайды. жаңадан- субгеномдық ядро ​​промоторынан MNV RdRp арқылы РНҚ синтезін бастады. Бұл деректер сонымен қатар GII.4 RdRp MNV RdRp қарағанда оның субгеномдық проскрипті тану үшін қосымша талаптары бар екенін көрсетеді.

MNV RdRp R411 және K259-мен салыстыруға болатын Q408R және A256K қалдықтарының алмастыруымен GII.4 RdRp Mps РНҚ синтезін сәл жақсартты. (А) WT және мутант GII.4 RdRps талдауда пайдаланылады. Гельдік кескінде SDS-PAGE арқылы бөлінген және Coomassie көгімен боялған тазартылған ақуыздар бар. GII.4 RdRp-де орындалған алмастырулар қалдықтарды MNV RdRp-те барларға өзгерту керек болды. (Б) Gps көмегімен WT және мутант GII.4 RdRps арқылы РНҚ синтезі. Барлық үш мутантты ақуыздың де жаңа инициация үшін де, праймерді ұзарту үшін де салыстырмалы әрекеттері болды. (C) Mps көмегімен WT және мутант GII.4 RdRps арқылы синтезделген РНҚ-ның гельдік кескіні. Осы талдаудағы әртүрлі RdRps арқылы жасалған 11-нт РНҚ мөлшері сандық түрде анықталады және гельдік кескіннің астында көрсетілген.

Субгеномдық промоторларды танудағы мутациялары бар MNV вирусының өндірісі

Біз MNV RdRp-дегі алмастырулардың sgRNA инициациясына әсер еткенін анықтауға тырыстық. in vitro жасушалардағы MNV РНҚ репликациясына әсер етеді. Төрт жұқпалы MNV cDNAs R411 (R411A) аланин алмастыруларымен, лизинді алмастырулармен (R411K), R416 (R416A) аланин алмастыруларымен немесе R411 және R416 (R411AR416A) аланинді алмастыруларымен NS7 экспрессиясы үшін құрастырылған. Әрбір жұқпалы клон BHK жасушаларына трансфекцияланды және жасуша лизаттары жиналды. TCID50 лизаттағы титр MNV жұқтыруы мүмкін BV-2 тышқанның микроглиальды жасушаларында анықталды. R411A және R411K мутанттарының вирустық титрлері WT MNV-ге қарағанда 10 және 3 есе төмен болды (сурет ​ (8А-сурет). 8A). R411A және R411K вирустарының реттілігі олардың инженерлік мутацияларды сақтайтынын және оларда басқа мутациялардың жоқтығын көрсетті. Вестерн блоктарда төрт вирустың барлығы NS7 протеинін өндірді (сурет ​ (8А-сурет). 8A ). R416A және R411AR416A вирустарын экспрессиялау үшін жасалған конструкциялар жұқпалы вирус шығара алмады (сурет ​ (8А-сурет). 8A ). Бір қызығы, NS7 белоктары осы BHK жасушаларында экспрессияланды, бұл R416 қалдығының мутацияға ұшырамайтынын және вирион өндірісін сақтай алмайтынын көрсетеді (сурет ​ (сурет 8A, 8A, төменгі панель).

Субгеномдық промотормен байланысқан MNV RdRp мутациялары MNV инфекциясы кезінде РНҚ синтезіне әсер етеді. (А) Субгеномдық промотордың байланыс орнында алмастырулары бар төрт вирустық құрылым үшін жасуша культурасының инфекциялық дозасы. Бағаналы диаграмма TCID қорытындылайды50 BHK жасушалары өндіретін және BV-2 жасушаларында титрленген мутант және WT вирустық құрылымдары үшін. Маңыздылық сынағы үшін One Way ANOVA пайдаланылды, одан кейін барлық мутанттарды WT-мен салыстыру үшін Даннетт пост-тесті қолданылды. ***П < 0,001, **П < 0,01, n = 3. Төменгі екі сурет MNV RdRp, NS7 және жүктеуді басқару, GAPDH жинақталуын анықтайтын батыс дақтарынан алынған. R416A және R411AR416A мутантты вирустары NS7 экспрессиялай алатынын, бірақ вирустық ұрпақ өндірілмегенін ескеріңіз. (Б) WT және мутант MNV арқылы вирустық ұрпақ түзілу кинетикасы. BV-2 жасушалары 1,0 MOI кезінде жұқтырылды. Өндірілген вирион саны шектеулі сұйылту инфекциясының талдауымен анықталды. Екі жұлдызша (**) a белгісін білдіреді П π,01 мәні. (C) BV-2 жасушаларында R411A және R411K MNV мутанттарының геномдық және субгеномдық РНҚ жинақталуы. Жоғарғы сурет BV-2 жасушаларын мутантты және WT MNV 3 MOI кезінде жұқтырғаннан кейін 9 сағаттан кейін алынған жалпы РНҚ-ның солтүстік бөлігінен алынған. ‘MW’ деп белгіленген жолақта молекулалық салмақ сатысы бар. Геномдық РНҚ және сгРНҚ (оң жақтағы екі жолақ) транскрипттері молекулалық массаны бақылау ретінде қызмет етеді. Геномдық және sgRNAs сандық көрсеткіші инфекциядан кейін 9 сағатта WT, R411A және R411K мутантты вирустардың үш тәуелсіз үлгілерінен алынған. Төменгі суретте солтүстік дақ үшін қолданылатын этидий бромидімен боялған денатурацияланатын агароз гелі. Жолақтар рибосомалық РНҚ және MW стандарты болып табылады. gRNA және sgRNA транскрипттері этидий бромидімен бояу арқылы анықталатындай мөлшерде жоқ.

BV-2 жасушаларының инфекциясы үшін R411A және R411K мутантты вирустарын сипаттадық. Жасушалар 1 TCID жұқтырған50 WT және мутантты вирустардың саны және 48 сағат ішінде анықталған вирустың мөлшері (сурет ​ (8В-сурет). 8B ). Мутант R411A ерте уақыт нүктелерінде вирустың аз мөлшерін шығарды, соның ішінде инфекциядан кейін 24 сағаттан кейін бір журналға азайды (сурет ​ (8В-сурет). 8B). Инфекциядан кейінгі 9 сағатта R411A және R411K мутанттарында геномдық және sgRNA деңгейлері төмендеді, бұл төмендеу R411A мутантымен ауыррақ болды (сурет ​ (8C сурет). 8C). Жалпы алғанда, бұл нәтижелер MNV субгеномдық промоторының шаш қыстырғышымен байланысатын MNV NS7 ақуызында анықталған R411 қалдығының MNV инфекциясы аясында MNV РНҚ өндірісі үшін маңызды екенін көрсетеді.


МАТЕРИАЛДАР МЕН ТӘСІЛДЕР

Рекомбинантты MNV RdRp және GII.4 RdRp экспрессиясы және тазартылуы

MNV RdRp кодтайтын cDNA MNV-1 CW1 штаммының (GenBank қосылу нөмірі: DQ285629.1) cDNA клонынан алынған полимеразды тізбекті реакция (ПТР) арқылы 5′ NdeI шектеуші эндонуклеаза ыдырау аймағын және BamHI сайтын қамту үшін күшейтілді. 3′ ұшы. Рестриктаза ферменттерінің қорытылуынан кейін кДНҚ клондалады ішек таяқшасы өрнек векторы pET15b (Novagen) N-терминуста алты-гистидиндік тегпен рекомбинантты MNV RdRp экспрессиялау үшін. MNV RdRp-дегі сайтқа тән мутациялар Quick-Change сайтқа бағытталған мутагенез жинағы (Agilent Technologies) арқылы енгізілді. Осы зерттеуде пайдаланылған барлық конструкциялар BigDye Terminator v3.1 циклды реттілік жинағымен (Қолданбалы биожүйелер) секвенирлеу арқылы расталды.

Вирустық геном көшірмелерін qPCR анықтау үшін қолданылатын праймер және зондтар

Праймер . MNV геномының қалдықтары. Жүйелі .
Сезім 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Антисенс 5137–5156 5′-GGCTGAATGGGGACGGCCTG
TaqMan зонд 5962–5076 5′-ATGAGTGATGGCGCA
Флюорофор FAM
Quencher ТАМИРА
Праймер . MNV геномының қалдықтары. Жүйелі .
Сезім 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Антисенс 5137–5156 5′-GGCTGAATGGGGACGGCCTG
TaqMan зонд 5962–5076 5′-ATGAGTGATGGCGCA
Флюорофор FAM
Quencher ТАМИРА
Праймер . MNV геномының қалдықтары. Жүйелі .
Сезім 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Антисенс 5137–5156 5′-GGCTGAATGGGGACGGCCTG
TaqMan зонд 5962–5076 5′-ATGAGTGATGGCGCA
Флюорофор FAM
Quencher ТАМИРА
Праймер . MNV геномының қалдықтары. Жүйелі .
Сезім 5028–5046 5′-CCGCAGGAACGCTCAGCAG
Антисенс 5137–5156 5′-GGCTGAATGGGGACGGCCTG
TaqMan зонд 5962–5076 5′-ATGAGTGATGGCGCA
Флюорофор FAM
Quencher ТАМИРА

ішек таяқшасы pET15bMNVRdRp плазмидісі бар Rosetta жасушалары 600 нм оптикалық тығыздық 0,6 мен 0,8 аралығына жеткенше 37°C температурада өсірілді. Изопропил тиогалактозид (IPTG) 16°C температурада 16–18 сағат бойы ақуыз экспрессиясын индукциялау үшін 1 мМ соңғы концентрацияға қосылды. Жасушалар центрифугалау арқылы жиналды және А лизис буферінде (100 мМ TrisCl, рН 7,9, 300 мМ NaCl, 10% глицерин, 15 мМ имидазол, 5 мМ β-меркаптоэтанол, тритон а ингибиторы [0,10%, тритон а 100% ингибиторы, рН 7,9, 300 мМ NaCl) қайта суспензияланды. Sigma–Oldrich]) және мұзда үш рет әрқайсысы 15 секундтан ультрадыбыстық әсер етті. Лизат 30 минут бойы 11 000 г центрифугалау арқылы тазартылды және үстіңгі зат өндірушінің нұсқауларына сәйкес Ni-NTA шайырымен араластырылды (Qiagen). Шлам бағанға оралып, құрамында 30 мм имидазол бар лизис буферімен мұқият жуылды және 200 мМ имидазолы бар лизис буферімен элюцияланды. Элюцияланған ақуыз сақтау буферінде (50 мМ TrisCl, рН 7,9, 300 мМ NaCl, 20% глицерин, 5 мм Дитиотреитол (DTT)) сақталды.

Рекомбинантты GII.4 norovirus RdRp бұрын сипатталғандай экспрессияланды және тазартылды (19). Қысқаша айтқанда, Топ 10 E. coli pBAD GII.4RdRp плазмидімен трансформацияланған жасушалар 37°C температурада OD дейін өсірілді.600 0,6 шамасында болды. l-арабиноза ақуыз экспрессиясын индукциялау үшін 0,02% соңғы концентрацияға қосылды. Жасушалар 37°C температурада 5 сағат бойы үздіксіз өсірілді, содан кейін центрифугалау арқылы жиналды және өндірушінің нұсқауларын қолдана отырып, Talon металға ұқсас шайырды (Clontech Laboratories) пайдаланып жасуша лизисі және тазарту үшін буфер А суспензиясында тоқтатылды. Рекомбинантты ақуыз құрамында 20 мМ имидазол бар лизис буферімен жуылды және 100 мМ имидазолы бар бірдей буфермен элюцияланды. Элюцияланған ақуыз құрамында 50 мМ 4-(2-гидроксиэтил)-1-пиперазинетансульфон қышқылы (HEPES) рН 7,9, 150 мМ NaCl, 20% глицерин, 5 мМ DTT бар буферде сақталды. Барлық рекомбинантты протеиндер Брэдфорд талдауын қолдану арқылы сандық анықталды және тазалығы Coomassie тамаша көк түспен боялған натрий додецил сульфаты-полиакриламидті гель электрофорезі (SDS-PAGE) арқылы бағаланды. Рекомбинантты ақуыздар болашақта пайдалану үшін -80°C температурада сақталды.

РНҚ синтезін талдау

RdRp талдаулары бұрын Yi сипаттағандай орындалды т.б. шағын өзгертулермен (25). Осы зерттеуде пайдаланылған барлық РНҚ, соның ішінде 4-тиуридилат (4-SU) барлар химиялық жолмен синтезделген (Thermo Scientific). MNV және GII.4 проскриптері MNV CW1 изоляты (DQ285629) nt 5012-ден 5059-ға дейін және GII.4 изоляты Hu/GII.4/MD-2004/2004/US (DQ658413) nt R5045-тен Bo штаммдарына сәйкес жобаланған. РНҚ синтезі кезінде радиоактивті таңбаланған 32 P-CTP қосылуына мүмкіндік беру үшін олардың 5′ ұшында үш вирустық емес нуклеотидтер (GCG) бар in vitro. Барлық РНҚ синтез реакциялары 20 мкл болды және құрамында 20 мМ натрий глутаматы (рН 8,2), 12,5 мМ дитиотреитол, 4 мМ MgCl болды.2, 1 мМ MnCl2, 0,5% Triton X-100 (көлем/көлем), 0,2 мМ гуанозинтрифосфаты (GTP), 0,1 мМ аденозинтрифосфат (АТФ) және уридинтрифосфаты (UTP), 33,3 нМ [α- 32 P]- цитидин (трифосфат) (цитидин трифосфаты) MP Biomedicals), 50 нМ шаблон РНҚ және 250 нМ рекомбинантты RdRp, егер басқаша көрсетілмесе. Реакция 30°C температурада 2 сағат бойы инкубацияланды, содан кейін этилендиаминтетрасірке қышқылын (ЭДТА) (рН 8.0) 10 мМ соңғы концентрацияға қосу арқылы тоқтатылды. РНҚ өнімдері тікелей құрамында 7,5 М мочевина бар 24% полиакриламидті гельге жүктелді. Радиоактивті таңбаланған РНҚ өнімдері PhosphoImager (Typhoon 9210 Amersham Biosciences) және ImageQuant бағдарламалық құралын пайдалану арқылы визуалды түрде көрсетілді және саны анықталды.

Қайтымды айқаспалы пептидтік саусақ ізін талдау (RCAP)

RCAP талдауы бұрын сипатталғандай орындалды (26). Қысқаша айтқанда, реакция 2 мкм тазартылған рекомбинантты MNV RdRp және 4 мкм химиялық синтезделген РНҚ бар 25 мкл көлемде орындалды. РНҚ-ақуыз кешендерін айқастыру үшін формальдегид 10 минут ішінде 0,1% (көлем/көлем) соңғы концентрацияға қосылды. 0,2 М глицинмен айқаспалы байланысты сөндіргеннен кейін секвенирлеуші ​​дәрежелі трипсин (Промега) 1:50 (б/ж) және 100 мМ NH қосылды.4HCO3 (рН 7,8) үлгіні 37°C температурада түнде қорыту үшін. 3 М LiCl РНҚ-пептид кешенін тұндыру үшін қолданылды, содан кейін екі 70% этанолды жуу. РНҚ-пептидті айқас байланыстар үлгілерді 50 мМ Tris pH 7,5, 200 мМ NaCl және 0,1% трифторсірке қышқылы бар буферде 70°C температурада 1 сағат инкубациялау арқылы өзгертілді. Үлгілер Ziptip бағанының (Millipore) көмегімен тазартылды және концентрацияланды және оң ион режимінде MALDI-ToF масс-спектрометриясы (MS) (Bruker Autoflex III Agilent Technologies) арқылы талданды. Тағайындалған шыңдардың барлығы MNV RdRp пептидтерінің теориялық массаларының 0,5 Да шегіне сәйкес келді.

4SU-алмастырылған РНҚ көмегімен proscript-RdRp қиылысуын салыстыру

RdRp қиылысу реакциялары түбі мөлдір 96 шұңқырлы микропластинада орындалды. Реакциялар көлемі 25 мкл болды және құрамында 20 мМ HEPES pH 7,5, 4 мМ MgCl бар буферде 2 мкм тазартылған MNV RdRp және 4 мкм 4SU таңбаланған РНҚ бар.2, 1 мМ MnCl2 және 1 мм DTT. Үлгілер мұздағы микропластинаға ауыстырылды және ультракүлгін (УК) 10 минут бойы 365 нм-де айқаспалы байланыс жасалды. Трипсиннің қорытылуы және пептид-РНҚ кешендерінің тұнбасы жоғарыда сипатталғандай болды. Түйіршік 50 мМ Tris pH 7,5, 200 мМ NaCl бар буферде тоқтатылды және 30 минут бойы 37°C температурада RNAse A (1 мкг) қорытылды. Пептидтер мен пептид-нуклеотид конъюгаттары C18 бағанының көмегімен тазартылды және наноспрей ион көзімен (Thermoc S) жабдықталған сыртқы калибрленген LTQ Orbitrap гибридті масс-спектрометрімен интерфейске қосылған наносұйықтық хроматография жүйесін (AB SCIEX) пайдаланып LC–ESI–MS/MS арқылы талданды. ). 12 мкл жылжымалы А фазасында ерітілген пептидтік дайджесттің 4 мкл аликвоты 15 мм × 100 мкм болатын кері фазалық C18 тұзақ бағанының көмегімен 5 мкл мин -1 ағын жылдамдығымен 5 минут бойы А буферімен жуылды. интеграфрит бағанасы және Magic C18 шайырымен қапталған (кеуек өлшемі 200 Å, бөлшектердің өлшемі 5 мкм Bruker-Michrom). Содан кейін тұзсыздандырылған пептидтер 150 мм × 75 мкм, 15 мкм ұшына оралған кері фазалық C18 бағанының (Magic C18, 100 Å, 5 мкм бөлшектердің өлшемі, Bruker-Michrom) көмегімен буфер В градиентімен бөлінді (Жаңа мақсат) және оң иондық режимде талданады. А буфері ацетонитрилдегі: судағы 0,1% құмырсқа қышқылынан (3%:97%, к/т) және В буферінде ацетонитрилдегі: судағы 0,1% құмырсқа қышқылынан (97%:3%, к/т) тұрды. Ағын жылдамдығы келесі градиентпен 300 нл мин −1 болды: 0–1 минуттан 3% B, 1–9 минуттан 10% B дейін, 9–28 минуттан бастап 30% B дейін, рампа – 40% B дейін 28–31 минуттан бастап, 31–35 минуттан 80% B деңгейіне дейін көтерілу, 36–43 минуттан бастап 90% B деңгейінде ұстаңыз, 43–44 минуттан бастап 3% B деңгейінде көтерілу, содан кейін бағанды ​​3% B деңгейінде қайта теңестіру 14 мин (жалпы орындалу уақыты 58 мин). Масс-спектрометр Orbitrap жүйесіндегі FT-MS сканерлеуі мен сызықтық ион тұзағындағы бес соқтығысты диссоциация (CID) сканерлеуі арасында ауыспалы деректерге тәуелді автоматтандырылған режимде жұмыс істеді. Orbitrap прекурсорлық иондарды бақылады м/з 300 дейін м/з 15 000 шешуші қуатта 2000. Әрбір сканерлеудегі бес ең қарқынды прекурсорлық иондар сызықтық тұзақта 2-мен оқшауланған. м/з оқшаулау ені және 35% нормаланған соқтығыс энергиясында белсендірілген. Динамикалық алып тастау 2 қайталау санымен 45 секундқа орнатылып, цикл бүкіл бөлу бойы үздіксіз қайталанды. 4SU-ға ковалентті түрде қосылған пептидтерді анықтау Proteome Discoverer™ бағдарламалық құралының көмегімен өңделмеген LC–MS/MS деректерін іздеу арқылы орындалды. SEQUEST ® протеин тізбегіне қарсы және ақуызға қосылған ықтимал 4SU құрылымдарына сәйкес келетін айнымалы модификацияларға мүмкіндік береді.

Флуоресценцияның поляризациясын талдау

Барлық талдаулар 20 мкл реакцияларда орындалды. 0,1 мкМ FL-MNV-проскрипті құрамында 10 мМ Tris–HCl pH 8,0, 30 мМ NaCl, 1% глицерин және 0,5 мМ 2-меркаптоэтанол бар реакция буферінде әртүрлі концентрацияларда MNV RdRp араласқан. Пластиналардан флуоресцентті поляризация деректерін оқу үшін Victor 3 V 1420 көп таңбалы есептегіш (Perkin Elmer) пайдаланылды. Қозу және эмиссия толқын ұзындығы сәйкесінше 485 және 535 нм болып белгіленді. Деректер MNV RdRp концентрациясына қарсы сызылған және деректер гиперболаға сәйкес болды (Ы = мин + (макс − мин) × С/(С + Қг)).

Дифференциалды сканерлеу флюориметриясы

Ақуыздардың термоденатурациялық профильдерін өлшеу үшін дифференциалды сканерлеу флюориметриясы (DSF) пайдаланылды. DSF нақты уақыттағы Stratagene MX3005P ПТР аппаратын пайдаланды. Әрбір үлгі 20 мМ натрий глутаматы (рН 8,2), 12,5 мм дитиотреитол, 4 мМ MgCl бар буфердегі SYPRO Orange (молекулярлық зондтар) соңғы концентрациясын қамтитын 25 мкл жалпы көлемде дайындалды.2 және 1 мМ MnCl2. Рекомбинантты MNV RdRp немесе мутант R411A 1:2 молярлық қатынаста Mps-пен араластырылды. Барлық реакциялар 0,5°C/мин жылдамдықпен және 25-тен 75°C-қа дейінгі температура диапазонында қолданылды. Нәтижелер GraphPad Prism көмегімен талданды және графигі салынды.

Жасушалар және плазмидтік құрылымдар

Тырнақ микроглиалды BV-2 жасушалық желісі 10% ұрықтың бұзау сарысуымен (FCS), 2 мМ л-глутаминмен, 0,075% натрий бикарбонатымен, 100 бірлік/мл пенициллинмен және стрептомицин (27). T7 РНҚ полимеразасын экспрессиялау үшін жасалған BHK жасушалары (BSR-T7 жасушалары, Карл-Клаус Конзелманнан, Людвиг Максимилиан университетінен, Мюнхен, Германия) құрамында 10% FCS, пенициллин (100 СИ бірлік/мл), стрептомицин (100) бар DMEM-де сақталды. мкг/мл) және 0,5 мг/мл G418. Кесілген T7 полимераза промоторының бақылауындағы WT MNV-1 геномын қамтитын cDNA клоны pT7: MNV3′ RZ бұрын жасалған (28).

Вирустарды қалпына келтіру және өсу қисығын талдау

R411A, R411K, R416A және R411/416AA мутациялары MNV-1 жұқпалы клонына (pT7:MNV 3′RZ) мутагендік ПТР қабаттасу арқылы енгізілді. Вирус кДНҚ клондарынан бұрын (24) сипатталған T7 РНҚ полимеразасын білдіретін рекомбинантты Fowlpox негізіндегі кері генетикалық жүйені пайдаланып құтқарылды. Қысқаша айтқанда, BSR-T7 жасушалары Lipofectamine 2000 (Invitrogen) көмегімен әрбір cDNA клонының 1 мкг трансфекциясы алдында шамамен 0,5 pfu/жасуша MOI-де T7 РНҚ полимеразасын экспрессиялайтын рекомбинантты Fowlpox вирусымен жұқтырылды. Трансфекциядан кейінгі қырық сегіз сағат (hpt), вирус бөлшектерін шығару үшін жасушалар -80 ° C температурада мұздатылған және ерітілген және 50% тін культурасының инфекциялық дозасын (TCID) алу үшін сұйылтуды шектеу арқылы титрленген.50) титрлеу BV-2 жасушаларында 10 есе сериялық сұйылтуларды пайдалана отырып жүргізілді. Вирустық TCID50 визуалды тексеру арқылы инфекциядан кейінгі 5 күндегі цитопатиялық әсер белгілеріне балл қою арқылы анықталды. Вирустық RdRp үшін Western blot жүктеуді бақылау ретінде қоянға қарсы MNV NS7 сарысуын (коммерциялық емес Ab) және тінтуірге қарсы GAPDH (Қолданбалы биосистема) пайдаланды. Қоян немесе тінтуірдің иммуноглобулиндерін танитын HRPO конъюгацияланған біріншілік және қайталама ешкі антиденелері хемилюминесценция арқылы анықталды (ECL, Amersham, GE Healthcare). Өткізу 1 өміршең вирустардың қорлары BV-2 жасушаларын (алты шұңқырлы тақталарға 1 × 10 5 тығыздықта себілген) 700 мкл қалпына келтірілген вируспен 1 ​​сағат бойы егу арқылы жасалды. РНҚ RT-ПТР күшейту және ДНҚ секвенциясы арқылы мутацияларды тексеру үшін GenElute™ жүйесін (Sigma–Aldrich) пайдаланып қорлардан алынды.

РНҚ-ның қайталама құрылымын болжау және ақуыз моделін құру

Осы зерттеудегі барлық РНҚ-ның қайталама құрылымдары Mfold (29) бағдарламасының көмегімен болжалды. MNV RdRp (PDB: 3QID) молекулалық графикасы мен талдаулары Калифорния университетінің Сан-Франциско Химера пакетімен (www.cgl.ucsf.edu/chimera) орындалды.


Мазмұны

Транскрипция болуы үшін РНҚ полимераза деп аталатын РНҚ синтездейтін фермент геннің жанында ДНҚ-ға қосылуы керек. Промоторларда РНҚ-полимеразаны және РНҚ-полимеразаны тартатын транскрипция факторлары деп аталатын ақуыздарды қауіпсіз бастапқы байланыстыру орнын қамтамасыз ететін жауап элементтері сияқты арнайы ДНҚ тізбегі бар. Бұл транскрипция факторларында белгілі бір промоторларға қосылатын және ген экспрессиясын реттейтін сәйкес нуклеотидтердің арнайы активаторы немесе репрессорлық тізбегі болады.

Бактерияларда Промотор РНҚ-полимераза және онымен байланысты сигма факторы арқылы танылады, ол өз кезегінде белсендіруші ақуыздың жақын жердегі өзінің ДНҚ байланыстыру орнына байланысуы арқылы промотор ДНҚ-ға жеткізіледі.Эукариоттарда Процесс күрделірек және РНҚ полимераза II промоторымен байланысуы үшін кемінде жеті түрлі фактор қажет.

Промоторлар берілген геннің транскрипция деңгейін бағыттау үшін басқа реттеуші аймақтармен (күшейткіштер, дыбыс өшіргіштер, шекаралық элементтер/изоляторлар) үйлесімді жұмыс істей алатын маңызды элементтерді білдіреді. Промотор РНҚ-полимеразаны тарту үшін транскрипция факторларын белсендіруге мүмкіндік беретін жасушадағы реттеуші белоктардың көптігінің немесе конформациясының өзгеруіне жауап ретінде индукцияланады. [2] [3]

Промоторлар әдетте қарастырылып отырған генге тікелей жақын орналасқандықтан, промотордағы позициялар белгілі бір ген үшін ДНҚ транскрипциясы басталатын транскрипциялық бастапқы орынға қатысты белгіленеді (яғни, жоғары ағындағы позициялар -1-ден кері санайтын теріс сандар, мысалы, -100 - 100 негізгі жұп жоғары ағын).

Жасуша ядросында промоторлар хромосомалық аумақтардың шетінде, мүмкін, әртүрлі хромосомалардағы гендердің бірлескен экспрессиясы үшін жақсырақ таралған сияқты. [4] Сонымен қатар, адамдарда промоторлар әрбір хромосомаға тән белгілі бір құрылымдық белгілерді көрсетеді. [4]

Эукариоттық өңдеу

  • Негізгі промотор – транскрипцияны дұрыс бастау үшін қажетті промотордың ең аз бөлігі [5]
    • Транскрипцияны бастау сайтын (TSS) және тікелей жоғарыдағы элементтерді қамтиды
    • РНҚ полимеразаны байланыстыратын орын
        : 18S, 5.8S және 28S рибосомалық РНҚ кодтайтын гендерді транскрипциялайды : хабаршы РНҚ және кейбір шағын ядролық РНҚ және микроРНҚ кодтайтын гендерді транскрипциялайды : тасымалдау РНҚ, 5s рибосомалық РНҚ және басқа да шағын РНҚ-ны кодтайтын гендерді транскрипциялайды
      • Бастапқы тораптың жоғары жағында шамамен 250 негізгі жұп
      • Спецификалық транскрипция факторын байланыстыру орындары
      • Одан әрі жоғарыдағы кез келген нәрсе (бірақ күшейткіш немесе ықпалы позициялық/бағдарлаудан тәуелсіз басқа реттеу аймағы емес)
      • Спецификалық транскрипция факторын байланыстыру орындары

      Бактериялық өңдеу

      Бактерияларда промоторда шамамен 10 (Pribnow Box) және 35 нуклеотидтер бар екі қысқа реттілік элементі бар. жоғары ағын транскрипцияны бастау сайтынан.

      • -10 (-10 элементі) қатарында TATAAT консенсус тізбегі бар.
      • -35 (-35 элементі) қатарында TTGACA консенсус тізбегі бар.
      • Жоғарыда келтірілген консенсус тізбегі орта есеппен сақталғанымен, көптеген промоутерлерде бұзылмаған. Орташа алғанда, әрбір консенсус тізбегіндегі 6 базалық жұптың тек 3-тен 4-ке дейін кез келген промоутерде кездеседі. Бүгінгі күні -10 және -35 элементтерінің толық сақталуы бар жасанды промоторлардың екеуінде де бүтін консенсус тізбегіне ие бірнеше табиғи промоторлар анықталды, оларда -10 және -35 элементтермен сәйкес келмейтіндер төмен жиілікте транскрипцияланады. консенсус.
      • -35 және -10 тізбектері арасындағы оңтайлы аралық 17 бит.
      • Кейбір промоутерлерде бір немесе бірнеше жоғары промоутер элементі (UP элементі) қосалқы тораптары бар [7] (консенсус тізбегі 5'-AAAAAARNR-3' -42 аймақта центрленген кезде консенсус тізбегі 5'-AWWWWWTTTT-3' -52 аймақта орталықта болғанда W = A немесе TR = A немесе GN = кез келген негіз). [8]

      Жоғарыда көрсетілген промоторлар тізбегі сигма-70 бар РНҚ-полимераза голоферментімен ғана танылады. Басқа сигма факторлары бар РНҚ полимераза голоферменттері әртүрлі негізгі промоторлар ретін таниды.

      Әрбір нуклеотидтің пайда болу ықтималдығы Өңдеу

      Эукариоттық өңдеу

      Эукариоттық промоторлар әртүрлі және оларды сипаттау қиын болуы мүмкін, алайда соңғы зерттеулер олардың 10-нан астам класқа бөлінгенін көрсетеді. [9]

      Гендік промоторлар әдетте геннің жоғары ағынында орналасады және транскрипцияның басталу орнынан бірнеше килобазалар қашықтықта реттеуші элементтері болуы мүмкін (күшейткіштер). Эукариоттарда транскрипциялық кешен ДНҚ-ның өзіне кері иілуін тудыруы мүмкін, бұл реттегіш тізбектерді транскрипцияның нақты орнынан алыс орналастыруға мүмкіндік береді. Эукариоттық РНҚ-полимераза II-тәуелді промоторларда TATA элементі (консенсус тізбегі TATAAA) болуы мүмкін, ол жалпы транскрипция факторы TATA-байланыстырушы ақуыз (TBP) және В тану элементі (BRE) арқылы танылады. TFIIB транскрипция факторы. [5] [10] [11] TATA элементі және BRE әдетте транскрипцияның басталу орнына жақын орналасады (әдетте 30-40 негізгі жұп ішінде).

      Эукариоттық промоторларды реттеуші реттілік әдетте транскрипциялық кешеннің түзілуіне қатысатын транскрипция факторлары деп аталатын ақуыздарды байланыстырады. Мысал ретінде негізгі спираль-цикл-спираль (bHLH) отбасындағы транскрипция факторларын байланыстыратын E-box (CACGTG тізбегі) болып табылады (мысалы, BMAL1-Clock, cMyc). [12] Бірнеше транскрипция факторларына бағытталған кейбір промоторлар транскрипциялық белсенділіктің жоғарылауына әкелетін гиперактивті күйге жетуі мүмкін. [13]

      Промоторлар күшейткіштермен, транскрипция факторларымен, медиатор кешенімен және сүтқоректілердің транскрипциясындағы ДНҚ ілмектерімен әрекеттеседі.

      Сүтқоректілердегі гендердің жоғары реттелетін экспрессиясы гендермен байланысты промоторларға сигналдар берілгенде басталады. Промоторлық ДНҚ тізбегі әртүрлі элементтерді қамтуы мүмкін, мысалы, CpG аралдары (промоторлардың шамамен 70% -ында бар), TATA қорабы (промоторлардың шамамен 24% -ында бар), инициатор (Inr) (промоторлардың шамамен 49% -ында бар), жоғары ағын және төмен TFIIB тану элементтері (BREu және BREd) (промоторлардың шамамен 22%-да бар) және төменгі ағындағы негізгі промотор элементі (DPE) (промоторлардың шамамен 12%-ында бар). [14] Промоторлардың CpG аралдарында бірнеше метилденген CpG учаскелерінің болуы гендердің тұрақты үнсіздігін тудырады. [15] Дегенмен, Weingarten-Gabbay және т.б. [16] басқа элементтердің болуы немесе болмауы ген экспрессиясына салыстырмалы түрде аз әсер ететінін көрсетті. Екі реттілік, TATA жәшігі және Inr, өрнектің шағын, бірақ айтарлықтай өсуіне себеп болды (тиісінше 45% және 28% өседі). BREu және BREd элементтері өрнекті тиісінше 35% және 20%-ға айтарлықтай төмендетті, ал DPE элементі өрнекке анықталған әсер етпеді. [16]

      Гендердің промоторларынан алыс орналасқан ДНҚ аймақтарында локализацияланған Cis-реттеу модульдері ген экспрессиясына өте үлкен әсер етуі мүмкін, кейбір гендер осындай cis-реттеу модулінің арқасында экспрессияны 100 есеге дейін жоғарылатады. [17] Бұл cis-реттеу модульдері күшейткіштерді, дыбысты өшіргіштерді, оқшаулағыштарды және байланыстыру элементтерін қамтиды. [18] Элементтердің осы шоқжұлдызының ішінде күшейткіштер және олармен байланысты транскрипция факторлары ген экспрессиясын реттеуде жетекші рөл атқарады. [19]

      Күшейткіштер – негізгі гендік реттеуші элементтер болып табылатын геномның аймақтары. Күшейткіштер жасуша түріне тән ген экспрессиясының бағдарламаларын басқарады, көбінесе олардың мақсатты гендерінің промоторларымен физикалық жақын болу үшін ұзақ қашықтықтарды айналып өту арқылы. [20] Ми қыртысының нейрондарын зерттеуде промоторларға күшейткіштерді әкелетін 24 937 ілмектер табылды. [17] Әрқайсысы көбінесе мақсатты гендерінен қашықтағы ондаған немесе жүздеген мың нуклеотидтерден тұратын бірнеше күшейткіштер өздерінің мақсатты ген промоторларына ілмектеп, ортақ мақсатты геннің экспрессиясын бақылау үшін бір-бірімен үйлестіреді. [20]

      Бұл бөлімдегі схемалық суретте мақсатты геннің промоторымен физикалық жақын болу үшін айналадағы күшейткіш көрсетілген. Цикл коннектор протеинінің димерімен (мысалы, CTCF немесе YY1 димері) тұрақтандырылған, димердің бір мүшесі күшейткіште өзінің байланыстыру мотивіне бекітілген, ал екінші мүшесі промотордағы байланыстыру мотивіне бекітілген (белгіленген суреттегі қызыл зигзагтар). [21] Бірнеше жасуша функциясына тән транскрипция факторлары (адам жасушасында 1600-ге жуық транскрипция факторлары [22]) әдетте күшейткіште [23] арнайы мотивтермен байланысады және жақындатқанда осы күшейткішпен байланыстырылған транскрипция факторларының шағын комбинациясы. ДНҚ ілмегі арқылы промоторға, мақсатты геннің транскрипция деңгейін басқарады. Медиатор (коактиватор) (әдетте өзара әрекеттесетін құрылымдағы шамамен 26 ақуыздан тұратын кешен) ДНҚ-байланысты транскрипция факторларының күшейткішінен реттеуші сигналдарды промотормен байланысқан РНҚ полимераза II (пол II) ферментіне тікелей жеткізеді. [24]

      Күшейткіштер белсенді болған кезде, әдетте суретте көрсетілгендей екі eRNA түзе отырып, екі түрлі бағытта әрекет ететін РНҚ полимеразалары бар ДНҚ-ның екі тізбегінен де транскрипцияланады. [25] Белсенді емес күшейткіш белсенді емес транскрипция факторымен байланысты болуы мүмкін. Транскрипция факторының фосфорлануы оны белсендіруі мүмкін, ал белсендірілген транскрипция факторы содан кейін ол байланысқан күшейткішті белсендіруі мүмкін (суреттегі күшейткішпен байланысқан транскрипция факторының фосфорлануын білдіретін кішкентай қызыл жұлдызды қараңыз). [26] Белсендірілген күшейткіш мақсатты геннен хабаршы РНҚ транскрипциясын бастау үшін промоторды белсендіруден бұрын РНҚ транскрипциясын бастайды. [27]

      Екі бағытты (сүтқоректілер) Өңдеу

      Екі бағытты промоторлар – екі бағытты ген жұбындағы гендердің 5' ұштары арасындағы ДНҚ-ның қысқа (<1 кб.п) аралық аралық аймақтары. [28] «Екі бағытты ген жұбы» қарама-қарсы жіптерде кодталған, олардың 5' ұштары бір-біріне бағытталған екі көрші генді білдіреді. [29] Екі ген көбінесе функционалды түрде байланысты және олардың ортақ промотор аймағының модификациясы оларды бірлесіп реттеуге және осылайша бірге экспрессиялауға мүмкіндік береді. [30] Екі жақты промоторлар сүтқоректілердің геномдарының ортақ ерекшелігі болып табылады. [31] Адам гендерінің шамамен 11%-ы екі жақты жұпталады. [28]

      Гендік онтология дерекқорындағы екі бағытты жұптастырылған гендер уақыттың 47% серіктестерімен кем дегенде бір дерекқор тағайындалған функционалдық санатты бөлісті. [32] Микромассивтік талдау екі жақты жұпталған гендердің кездейсоқ гендерге немесе көршілес бір бағытты гендерге қарағанда жоғары дәрежеде бірге экспрессияланатынын көрсетті. [28] Бірлескен экспрессия міндетті түрде бірлескен реттеуді көрсетпесе де, екі жақты промотор аймақтарының метилденуі екі генді де төмендетеді, ал деметилденуі екі генді де жоғары реттейді. [33] Алайда бұған ерекше жағдайлар бар. Кейбір жағдайларда (шамамен 11%) екі жақты жұптың тек бір гені экспрессияланады. [28] Бұл жағдайларда промотор экспрессияланбаған генді басуға қатысады. Мұның артындағы механизм бірдей полимеразалар үшін бәсекелестік немесе хроматинді модификациялау болуы мүмкін. Дивергентті транскрипция бір геннің транскрипциясын жоғарылату үшін нуклеосомаларды ауыстыруы немесе бір геннің транскрипциясын төмендету үшін байланыстырылған транскрипция факторларын жоюы мүмкін. [34]

      Гендердің кейбір функционалдық кластары басқаларға қарағанда екі жақты жұпталады. ДНҚ репарациясына қатысатын гендер бір бағытты промоторларға қарағанда екі жақты промоторлармен реттелу ықтималдығы бес есе жоғары. Шаперон белоктары үш есе, ал митохондриялық гендер екі есе ықтимал. Көптеген негізгі шаруашылық және жасушалық метаболикалық гендер екі бағытты промоторлармен реттеледі. [28] Екі жақты жұптастырылған ДНҚ жөндеу гендерінің шамадан тыс көрсетілуі бұл промоторларды қатерлі ісікпен байланыстырады. Адамның соматикалық онкогендерінің 45 пайызы екі жақты промоторлармен реттелетін сияқты, бұл ісік тудырмайтын гендерден айтарлықтай көп. WNT9A/CD558500, CTDSPL/BC040563 және KCNK15/BF195580 гендік жұптары арасындағы промоторлардың гиперметиляциясы ісіктермен байланысты болды. [33]

      Екі жақты промоторларда белгілі бір реттілік сипаттамалары байқалды, соның ішінде TATA қораптарының жетіспеушілігі, CpG аралдарының көптігі және бір жағында басым Cs және As, ал екінші жағында Gs және Ts ортасының айналасындағы симметрия. CGCG элементі деп те аталатын TCTCGCGAGA консенсус тізбегі бар мотив жақында CpG аралдарында PolII басқаратын екі бағытты транскрипцияны жүргізетіні көрсетілді. [35] CCAAT қораптары кең таралған, өйткені олар TATA қораптары жоқ көптеген промоутерлерде болады. Сонымен қатар, NRF-1, GABPA, YY1 және ACTACAnnTCCC мотивтері екі бағытты промоторларда бір бағытты промоторларға қарағанда айтарлықтай жоғары жылдамдықпен ұсынылған. Екі жақты промоутерлерде TATA жәшіктерінің болмауы TATA қораптарының промоутерлердің бағыттылығын анықтауда рөл атқаратынын көрсетеді, бірақ екі бағытты промоутерлердің қарсы мысалдары TATA қораптарына және оларсыз бір бағытты промоторларға ие, олардың жалғыз фактор бола алмайтынын көрсетеді. [36]

      «Екі бағытты промотор» термині мРНҚ-кодтаушы гендердің промоторлық аймақтарына қатысты болса да, люциферазалық талдаулар адам гендерінің жартысынан көбінде күшті бағытты ығысуы жоқ екенін көрсетті. Зерттеулер кодтамайтын РНҚ жиі мРНҚ кодтаушы гендердің промоторлық аймақтарымен байланысты екенін көрсетеді. РНҚ-полимераза II-нің тартылуы мен инициациясы әдетте екі жақты басталады, бірақ ұзарту кезінде дивергентті транскрипция бақылау пунктінде кейінірек тоқтатылады деген болжам бар. Бұл реттеудің артындағы ықтимал механизмдерге промотор аймағындағы реттілік, хроматин модификациясы және ДНҚ-ның кеңістіктік бағдары жатады. [34]

      Субгеномдық промотор – белгілі бір гетерологиялық ген үшін вирусқа қосылатын промотор, нәтижесінде тек осы ген үшін мРНҚ түзіледі. Көптеген оң мағыналы РНҚ вирустары осы субгеномдық мРНҚ-ларды (sgRNA) осы вирустар қолданатын жалпы инфекция әдістерінің бірі ретінде жасайды және әдетте кеш вирустық гендерді транскрипциялайды. Субгеномдық промоторлар 24 нуклеотидтен (Sindbis вирусы) 100-ден астам нуклеотидтерге (Қызылша некротикалық сары вена вирусы) дейін ауытқиды және әдетте транскрипция басталған кезден жоғары болады. [37]

      Промоторларды геномдық реттілікте анықтауды жеңілдету үшін алгоритмдердің алуан түрлілігі әзірленді, ал промоторларды болжау көптеген генді болжау әдістерінің ортақ элементі болып табылады. Промоутер аймағы -35 және -10 Consensus тізбектерінің алдында орналасқан. Промоторлық аймақ консенсус тізбегіне неғұрлым жақын болса, сол геннің транскрипциясы жиірек болады. Консенсус тізбегі сияқты промоутер аймақтар үшін белгіленген үлгі жоқ.

      Промоторлар тізбегіндегі өзгерістер эволюцияда маңызды болып табылады, бұл көптеген ұрпақтардағы гендердің салыстырмалы тұрақты санымен көрсетілген. Мысалы, омыртқалы жануарлардың көпшілігінде белокты кодтайтын гендердің шамамен бірдей саны (шамамен 20 000) бар, олар жиі реттілікпен сақталады, сондықтан эволюциялық өзгерістердің көп бөлігі ген экспрессиясының өзгеруіне байланысты болуы керек. [4] [9]

      Де жаңадан шыққан промоутерлер Өңдеу

      Көптеген промотор элементтерінің қысқа реттілігін ескере отырып, промоторлар кездейсоқ тізбектерден жылдам дами алады. Мысалы, в E. coli,

      Кездейсоқ тізбектердің 60%-ы бір ғана мутациясы бар жабайы типті лак промоторымен салыстырылатын өрнек деңгейлерін дамыта алады және бұл

      Кездейсоқ тізбектердің 10% тіпті эволюциясыз белсенді промоторлар ретінде қызмет ете алады. [39]

      Басқа соңғы зерттеулер гендердің промоторлары қант диабетінің негізгі себебі болуы мүмкін екенін көрсетеді. [40] Геномдық қауымдастық зерттеулері (GWAS) арқылы қант диабетімен байланысты гендердің промоторлары әрбір фенотип үшін арнайы ДНҚ үлгілерін көрсетеді. [40] Бұл бақылау осы гендердің промоторлары қант диабетінің әрбір фенотипі үшін арнайы транскрипция факторларын қолданатынын көрсетеді. [40]

      Транскрипцияның басталуы бірнеше механизмдерді қамтитын көп сатылы дәйекті процесс: промотордың орналасуы, РНҚ-полимеразаның бастапқы қайтымды байланысуы, РНҚ-полимеразаның конформациялық өзгерістері, ДНҚ-дағы конформациялық өзгерістер, нуклеозид-трифосфаттың (NTP) функционалды РНҚ-полимераза-промоторымен байланысуы. РНҚ синтезінің күрделі және өнімді емес және өнімді бастамасы. [41]

      Промоторларды байланыстыру процесі геннің экспрессия процесін түсіну үшін өте маңызды.

      Орналасқан жерді өңдеу

      РНҚ-полимераза голоферментінің ДНҚ-ның спецификалық емес жерлеріне жоғары жақындығын көрсеткенімен, бұл сипаттама промоторлардың орналасу процесін нақтылауға мүмкіндік бермейді. [42] Промоторлардың орналасуының бұл процесі голоферменттің ДНҚ-ға және сигма 4-тің ДНҚ кешендерінің құрылымына жатқызылған. [43]

      Көптеген аурулардың себептері бойынша гетерогенді, яғни бір «ауру» көбінесе молекулалық деңгейде әртүрлі аурулар болып табылады, дегенмен симптомдар мен емдеуге жауап бірдей болуы мүмкін. Молекулярлық шығу тегі әртүрлі аурулардың емдеуге қалай жауап беретіні ішінара фармакогеномика пәнінде қарастырылады.

      Мұнда патологиялық хромосомалық транслокация арқылы химерикалық гендердің пайда болуына байланысты аберрантты транскрипциялық реттелуі бар ісіктердің көптеген түрлері көрсетілмеген. Маңыздысы, промоторлармен байланысқан ақуыздардың санына немесе құрылымына араласу - мақсатты генмен элементтерді бөлісетін байланысты емес гендердің экспрессиясына әсер етпей, ауруды емдеудің бір кілті. [44] Өзгеруі қажет емес кейбір гендер жасушаның қатерлі ісікке айналу мүмкіндігіне әсер ете алады. [45]

      Адамдарда геннің транскрипция басталатын жеріне жақын орналасқан промоторлардың шамамен 70%-ында (проксимальды промоторлар) CpG аралы бар. [46] [47] CpG аралдарының ұзындығы әдетте 200-ден 2000 жұпқа дейін, C:G базалық жұбының мазмұны >50% және ДНҚ аймақтары бар, онда цитозин нуклеотидінен кейін гуанин нуклеотиді болады және бұл сызықтық жағдайда жиі кездеседі. оның 5' → 3' бағыты бойынша негіздер тізбегі.

      Дистальды промоторлардың құрамында ДНҚ жөндеу генінің промоутері сияқты CpG аралдары жиі болады ERCC1, мұнда CpG аралы бар промотор кодтау аймағының жоғары ағынында шамамен 5400 нуклеотидте орналасқан. ERCC1 ген. [48] ​​CpG аралдары микроРНҚ сияқты функционалды кодталмаған РНҚ промоторларында жиі кездеседі.

      Адамдарда ДНҚ метилденуі 5-метилцитозиндерді қалыптастыру үшін CpG учаскелеріндегі цитозин қалдықтарының пиримидин сақинасының 5' позициясында жүреді. Промоторлардың CpG аралдарында бірнеше метилденген CpG учаскелерінің болуы гендердің тұрақты үнсіздігін тудырады. [15] Геннің дыбысын өшіру басқа механизмдермен басталуы мүмкін, бірақ бұл көбінесе геннің тұрақты үнсіздігін тудыру үшін CpG промотор аралындағы CpG учаскелерінің метилденуімен жалғасады. [15]

      Жалпы, қатерлі ісікке ұласқанда, жүздеген гендердің дыбысы өшіріледі немесе белсендіріледі. Қатерлі ісіктердегі кейбір гендердің дыбыссыздануы мутация арқылы жүзеге асса да, канцерогендік гендердің үнсіздігінің үлкен бөлігі ДНҚ метилденуінің өзгеруінің нәтижесі болып табылады (рактағы ДНҚ метилденуін қараңыз). Қатерлі ісік ауруында үнсіздікті тудыратын ДНҚ метилденуі, әдетте, ақуызды кодтайтын гендердің промоторларында болатын CpG аралдарының бірнеше CpG орындарында орын алады.

      МикроРНҚ-ның өзгерген өрнектері қатерлі ісікке ұласатын көптеген гендерді де өшіреді немесе белсендіреді (рактағы микроРНҚ-ны қараңыз). Өзгертілген микроРНҚ экспрессиясы микроРНҚ транскрипциясын бақылайтын промоторларда CpG аралдарында CpG сайттарының гипер/гипо-метиляциясы арқылы жүреді.

      Промоторларындағы CpG аралдарының метилденуі арқылы ДНҚ репарация гендерін дыбыссыздандыру ісік ауруының өршуінде әсіресе маңызды болып көрінеді (рак ауруында ДНҚ репарация гендерінің метилденуін қараңыз).

      Промоутерге сілтеме жасау үшін канондық реттілік терминін пайдалану жиі проблемалық болып табылады және промоутер тізбегі туралы түсінбеушіліктерге әкелуі мүмкін. Канондық қандай да бір мағынада мінсіз дегенді білдіреді.

      Транскрипция факторын байланыстыру орнында белгілі бір жасушалық жағдайларда ақуызды ең күшті байланыстыратын бір реттілік болуы мүмкін. Мұны канондық деп атауға болады.

      Дегенмен, табиғи сұрыптау транскрипциялық нәтижені реттеудің тәсілі ретінде аз энергетикалық байланыстыруды қамтамасыз етуі мүмкін. Бұл жағдайда популяциядағы ең көп таралған тізбекті жабайы типті тізбек деп атауға болады. Бұл тіпті басым жағдайларда болуы мүмкін ең тиімді бірізділік болмауы мүмкін.

      Соңғы дәлелдер сонымен қатар бірнеше гендердің (соның ішінде прото-онкоген c-myc) әлеуетті реттеуші сигналдар ретінде G-төртбұрышты мотивтері бар екенін көрсетеді.

      Көптеген генетикалық аурулардың кейбір жағдайлары промоторлардың немесе транскрипция факторларының өзгеруімен байланысты.

      Кейбір промоторларды конститутивтік деп атайды, өйткені олар жасушадағы барлық жағдайларда белсенді болады, ал басқалары реттеледі, тек белгілі бір тітіркендіргіштерге жауап ретінде жасушада белсенді болады.


      Субгеномдық промотор дегеніміз не? - Биология

      Бұл Ser қолданбасының жалғасы. № 08/197,222, 1994 жылғы 16 ақпанда берілген, қазір қараусыз қалдырылған, бұл Сер өтінішінің жалғасы. № 08/069,457, 1993 жылғы 1 маусымда берілген, қазір қараусыз қалдырылған, бұл Сер өтінішінің жалғасы болып табылады. № 07/683,516, 1991 жылғы 8 сәуірде берілген, қазір қараусыз қалды, бұл Сер өтінішінің жалғасы болып табылады. № 07/168,691, 1988 жылғы 16 наурызда берілген, қазір қараусыз қалдырылған және Сердің бір бөлігінің жалғасы. № 07/368,939, 1989 жылғы 19 маусымда берілген, қазір қараусыз қалдырылған, бұл Сердің жалғасы. № 06/709,181, 1985 жылғы 7 наурызда берілген, қазір қалдырылған.

      1. Тобамовирустардан, тобравирустардан, бромовирустардан, кукумовирустардан және жоңышқа мозаикалық вирусынан тұратын топтан таңдалған (+) тізбекті өсімдік РНҚ вирусының субгеномдық өзек промоторының нуклеотидтер тізбегін қамтитын жасанды түрде жасалған рекомбинантты ДНҚ молекуласы AUCUAUGUU және оған бір сәйкессіздігі бар тізбектерден тұратын топтан таңдалған консенсус тізбегін қамтиды және аталған (+) тізбекті РНҚ вирусы бұдан әрі BstXI сайтынан сәйкес cDNA-ның BglII сайтына дейінгі нуклеотидтер тізбегіне сәйкес активтендіргіш доменді қамтиды. суреттегі РНҚ-ға. 2 және мұнда аталған белсендіру домені аталған субгеномдық негізгі промоторлар тізбегіне 5' орналасады.

      2. 1-баптың рекомбинантты ДНҚ молекуласы, мұнда аталған субгеномдық өзек промоторы бром-мозаикалық вирустың субгеномдық промоторы болып табылады.

      3. 2-баптың субгеномдық промоторын қамтитын және одан әрі аталған субгеномдық промотордың реттеуші бақылауындағы өсімдік экспрессивті генін қамтитын рекомбинантты ДНҚ молекуласы.

      4. 2-баптың рекомбинантты ДНҚ молекуласы, мұнда аталған субгеномдық промотор суреттегі РНҚ-ға сәйкес cDNA-ның BglII учаскесінен SalII учаскесіне дейінгі негізгі промоторлар тізбегін қамтиды. 2 және одан әрі BstXI сайтынан 3-суреттегі РНҚ-ға сәйкес cDNA-ның BglII учаскесіне дейінгі белсендіру тізбегін қамтиды. 2, мұнда аталған белсендіру домені субгеномдық транскрипцияның басталу алаңының жоғары ағынында 95 нуклеотидтен аспайды.

      5. 2-баптың рекомбинантты ДНҚ молекуласы, мұнда аталған субгеномдық промотор суреттегі РНҚ-ға сәйкес cDNA-ның BglII сайтынан SalI учаскесіне дейінгі негізгі промоторлар тізбегін қамтиды. 2 және одан әрі AvaI сайтынан 3-суреттегі РНҚ-ға сәйкес cDNA-ның BglII сайтына дейінгі белсендіру тізбегін қамтиды. 2, мұнда аталған белсендіру домені субгеномдық транскрипцияның басталу алаңының жоғары ағынында 95 нуклеотидтен аспайды.

      6. 2-баптың рекомбинантты ДНҚ молекуласы, бұдан әрі аталған субгеномдық өзек промоторының екінші көшірмесін және аталған белсендіру доменінің екінші көшірмесін қамтиды, мұнда аталған белсендіру доменінің аталған екінші көшірмесі субгеномдық ядро ​​промоторының аталған екінші көшірмесіне 5' орналасады. екінші субгеномдық промоторды құрайды және аталған екінші субгеномдық промотор аталған рекомбинантты ДНҚ молекуласының РНҚ көшірмесі ішінде аталған екінші субгеномдық промотордың жұмыс істеуіне мүмкіндік беру үшін аталған жасанды түрде жасалған рекомбинантты ДНҚ молекуласының ішінде орналасқан.

      7. Субгеномдық промотордан тұратын жасанды түрде құрастырылған рекомбинантты ДНҚ молекуласы, мұнда аталған субгеномдық промотор BstXI сайтынан бром мозаикалық вирусынан 6-суреттегі РНҚ-ға сәйкес cDNA-ның SalI учаскесіне дейінгі нуклеотидтер тізбегін қамтиды. 2 және бром-мозаикалық вирустың белсендіру доменінің көшірмелері, мұнда аталған қайталанатын реттілік AvaI сайтынан 6-суреттегі РНҚ-ға сәйкес cDNA-ның BgllI сайтына дейін. 2, онда аталған қайталанатын белсендіруші домен тізбегі субгеномдық транскрипцияның басталу алаңының жоғары ағынында шамамен 220 нуклеотидте орналасқан, аталған субгеномдық промотор бұдан әрі AUCUAUGUU және оған бір сәйкессіздігі бар тізбектерден тұратын топтан таңдалған консенсус тізбегін және аталған молекубинантты DNA одан әрі қамтиды. аталған субгеномдық промотордың реттеуші бақылауындағы өсімдікпен экспрессияланатын генді қамтиды.

      Бұл өнертабыстың саласы молекулалық биология саласы болып табылады және ол әсіресе (+) тізбекті РНҚ вирустары саласына қатысты. Осы өнертабыстың ілімдері тиісті жасуша иесінде бағытталған ген экспрессиясы үшін субгеномдық промотор деп аталатын вирустық бақылау тізбегін пайдалануға мүмкіндік береді. Атап айтқанда, бром-мозаикалық вирустың RNA3 субгеномдық промоторы өсімдік тініндегі құрылымдық геннің экспрессиясын күшейту үшін мысалға келтірілген.

      ӨРТІБІШТІҢ ФОНЫ

      Ие жасушаларының цитоплазмасында репликациялануға қабілетті бір тізбекті РНҚ вирустары табиғатта кең таралған. Хабарды сезетін геномдық РНҚ молекулалары бар бір тізбекті вирустар (+) тізбекті немесе оң тізбекті, РНҚ вирустары деп аталады. Белгілі (+) тізбекті РНҚ вирустарының ішінде бактерияға, жануарға, өсімдікке спецификалық сорттар бар. Вирус бөлшектерінің морфологиясында, пальто белоктарында, генетикалық ұйымда және геном өлшемінде көп алуандық бар. (+) тізбегі РНҚ вирустарына Q-бета бактериофаг, полиовирус және жануарлар жасушаларының альфавирустары (соның ішінде Синдбис вирусы), бромовирустар (бром-мозаикалық вирусты қоса) және комовирустар (қияр мозаикалық вирусын қоса) кіреді, бірақ олармен шектелмейді. өсімдіктерден.

      (+) жіпті вирус репликациясына жалпы шолу жарияланды (E. Strauss and J. Strauss (1983) Curr. Top. Microbiol. Immunol. 105:1). Қадамдардың қысқаша мазмұны төменде келтірілген. Инфекцияның пайда болуы үшін вирустық анықталған ақуыздар геномдық РНҚ(S)-мен бірге қажет болуы мүмкін немесе вирус репликациясын бастау үшін қажетті барлық вирустық ақуыздар хабарлама ретінде кіріс вирустық геномдық РНҚ арқылы синтезделуі мүмкін. Бұл вирустардың нуклеин қышқылының репликациясында ДНҚ аралық өнімі жоқ (+) тізбегі РНҚ вирусының генетикалық ақпаратының репликациясы үшін мұндай вирустармен зақымдалған жасушалардың РНҚ-ға тәуелді РНҚ синтетикалық қабілеті қажет. Кіріс геномдық (+) тізбегі (-) тізбекті молекулалардың синтезі үшін шаблон ретінде қызмет етеді, содан кейін (-) тізбектерді шаблон ретінде пайдалану арқылы ұрпақ (+) тізбектері синтезделеді. Соңғы сатыда (-) тізбекті молекулалар үстінде (+) жіптердің күшейтілуі жүреді. Вирустық РНҚ молекула(лар)ының (+) тізбегі әдетте вирусқа тән репликазаны алу үшін, кем дегенде ішінара аударылады. (-) жіптер құрылымдық гендерді тасымалдауы мүмкін және қабық ақуызымен инкапсидалануға арналған (+) жіптердің үлкен санының кейінгі синтезі үшін шаблон ретінде қызмет етеді. Құрылымдық белоктар вирусқа байланысты геномдық РНҚ-дан немесе субгеномдық РНҚ-дан аударылады. Көпкомпонентті РНҚ геномдары бар (+) тізбекті вирустар жағдайында РНҚ молекулалары бөлек вирустық бөлшектерге инкапсидалануы мүмкін, бұл жағдайда өнімді инфекцияны беру үшін хост жасушасы әрбір компонентпен бір мезгілде жұқтырылуы керек.

      Өсімдік (+) тізбегі РНҚ вирустары екі супертопқа жіктелген (R. Goldbach (1986) Ann. Rev. Phytopathol. 24:289). Пикорнавирус тәрізді супертопқа комовирустар, неповирустар және поливирустар кіреді, ал екінші супертопқа жануарлардың альфавирусы Sindbis вирусына ұқсайтын вирустар кіреді: тобамовирустар, тобравирустар, бромовирустар, кукумовирустар және жоңышқа мозаикалық вирусы. Өсімдіктер мен жануарлардың (+) тізбегі РНҚ вирустары иесінің диапазонына, геномы мен бөлшектерінің құрылымына және вирустық репликацияның нақты механизмдеріне байланысты әр түрлі болғанымен, кейбір аминқышқылдары мен нуклеин қышқылы тізбегінің гомологиясы бар (Р. Голдбахта (1987) қаралған). ) Микробиол.Ғылым 4:197). Полиомиелит, аусыл және сиыр мозаикалық вирустары (H. Franssen et al. (1984) EMBO J.3:855) және бромды мозаикалық вируспен кодталған құрылымдық емес ақуыздар, жоңышқа мозаикасы үшін аминқышқылдарының реттілігінің гомологиялары сипатталған. вирус, темекі мозаикалық вирусы және Синдбис вирусы (J. Haseloff et al. (1984) Proc. Nat. Acad. Sci. USA 81:4358 P. Ahlquist et al. (1985) J. Virol. 53:536). Құрылымдық емес ақуыздардағы гомологиялық аймақтар вирустық нуклеин қышқылының репликациясындағы механикалық ұқсастықтарды және мүмкін эволюциялық қатынастарды көрсетеді деп саналады.

      Альфавирустар мен Синдбис тәріздес өсімдік вирустары да жабын ақуызын синтездеудің ортақ стратегиясын бөліседі (кейбір жағдайларда қосымша ақуыз(лар) синтезі үшін). Бұл стратегия га синтезін бағыттау үшін ішкі промоторды пайдалану болып табылады. +) шаблон ретінде (-) жіпті қолданатын субгеномдық РНҚ деп аталатын тізбекті РНҚ молекуласы Субгеномдық РНҚ сәйкес "геномдық" (толық ұзындықтағы) РНҚ-да табылған тізбектердің ішкі жиынын қамтиды және вирустық бөлшектермен инкапсидалануы мүмкін. Бром мозаикалық вирусы (BMV) жағдайында (+) тізбекті РНҚ молекулалары толық ұзындықтағы (-) тізбек үлгісінен шамамен 100-ден 1-ге дейін артық, ал субгеномдық және толық ұзындықтағы геномдық РНҚ шамамен эквимолярлық мөлшерде жасалады (француз және Ahlquist (1987) Дж.Вирол.61:1457).BMV-де тек қабық ақуызы туралы хабарламаны тасымалдайтын субгеномдық мРНҚ жасушалық ақуыздың синтетикалық аппаратымен өте тиімді аударылады.Мысалы, BMV жұқтырған өсімдік ұлпасының грамм саны. с миллиграмм мөлшерін синтездейді сұлы ақуызы (L. Лэйн (1981) Өсімдіктердің вирустық инфекциялары мен салыстырмалы диагностикасының анықтамалығында, E. Kurstak, Ed., Elsevier/North-Holland, Amsterdam, pp.333-376).

      Бромовирустар – үш жақты геномы бар (+) өсімдік вирустарының тобы. Бұл топқа бром мозаикалық вирусы, сиыр бұршақының хлоротикалық мозаикалық вирусы (CCMV) және кең бұршақ мозаикалық вирусы (BBMV) кіреді. CCMV және BBMV тиісінше қос тұқымды сиыр бұршақтары мен кеңбұршақтарды жұқтырады, ал BMV қоздырғышы дәнді дақылдарды қоса алғанда, шөптер болып табылады (L. C. Lane, (1981) The Handbook of Plant Virus Infections and Comparative Diagnosis, 12 тарау, Elsevier, Амстердам). Арпа жақсы сипатталған BMV үшін жалпы тәжірибелік иесі болып табылады.

      BMV штаммы M1 (Madison 1) (P. Ahlquist және т. BMV геномы бірегей, белгілі бірізділіктің үш РНҚ молекуласынан тұрады: RNA1 ұзындығы 3234 негіз, RNA2 ұзындығы 2865 негіз (P. Ahlquist et al. (1984) J. Mol. Biol. 172:369) және RNA3 ұзындығы шамамен 2114 негіз (P. Ahlquist et al. (1981) J. Mol. Biol. 153:23). Толық кДНҚ клондары өндірілді (P. Ahlquist және M. Janda (1984) Mol. Cell. Biol. 4:2876). 1 және 2-РНҚ жеке инкапсидтелген RNA3 RNA4-пен бірге инкапсидаланады, 876 негізгі субгеномдық қабық ақуызы хабарламасы in vivo репликацияланбайды деп болжанады (T. Lane (1974) Adv. Virus Res. 19:151). Вирус бөлшектерінен тазартылған РНҚ молекулалары және клондалған вирустық cDNA тізбегінен дайындалған транскрипттер арпа протопластының үлгі жүйесінде жұқпалы болып табылады (P. Ahlquist et al. (1984) Proc. Nat. Acad. Sci. USA 81:7066). Сондықтан BMV нуклеин қышқылының функционалдық реттілігін талдау үшін молекулалық биологиялық әдістердің толық спектрі қол жетімді.

      Клондалған BMV геномының эксперименттік манипуляциялары функционалдық маңызды аймақтарды анықтауға кірісті (P. Ahlquist және R. French (1988) Доминго, Голландия және Ahlquist (eds.) РНҚ генетикасы 2-кітап: РНҚ өзгергіштігі, 3 тарау, CRC Press, Орландо, Флорида). 1 және 2 РНҚ және олардың ген өнімдері вирустық РНҚ синтезі үшін қажет RNAs1 және 2 сәйкесінше құрылымдық емес ақуыздарды 1a және 2a кодтайды және бұл белоктар РНҚ-тәуелді РНҚ полимераза белсенділігін анықтайды. RNA3 құрылымдық емес ақуыз 3a және қабық ақуызын кодтайды, бірақ вирустық РНҚ репликациясы үшін RNA3, ақуыз 3а да, қабық ақуызы да қажет емес (R. French and P. Ahlquist (1986) Science 231:1294). RNA3 жабын протеинінің генінің орнына бөтен генді енгізу арқылы немесе репликация қабілетін жоғалтпай белгілі бір делециялар арқылы өзгертілуі мүмкін (АҚШ патенттік өтінімі Сер. № 709,181, 1985 ж. 7 наурызда берілген R. French et. басқалар (1986) Ғылым 231:1294). RNA3 жақсы зерттелген, өйткені оның ген өнімдері РНҚ репликациясына қажет емес (French et al. 1986). Молекуланың 5' және 3' кодталмаған ұштарында 1 және 2 РНҚ-да гомологтары бар аймақтар бар және бұл тізбектер вирустық РНҚ-полимеразаны тануда, инкапсидацияны бастауда, молекулаларды вирустан қорғауда жұмыс істей алады деп ұсынылды. жасушалық нуклеазалар немесе осы функциялардың комбинациясы. Клондалған cDNA және in vitro транскрипттерін пайдалана отырып жоюды зерттеу геномдық РНҚ репликациясы үшін 5' және 3' ұштарының бөліктері қажет екенін және РНҚ3 интерцистрондық аймағында да делециялардың дәрежелі әсері бар екенін көрсетті (Р. Француз және П.Ахлквист (1987) Дж.Вирол.61:1457). Интерцистрондық аймақтың бір ерекшелігі - табиғи вирус популяцияларында ұзындығы 16-22 нуклеотидтен тұратын олиго(А) тракт (P. Ahlquist et al. (1981) J. Mol. Biol. 153:23). BMV субгеномдық промоторы интерцистрондық аймақта да орналасқан. BMV-нің геномдық та, субгеномдық промоторлары да иесінің РНҚ полимеразаларымен танылмайды, тек вирусты жұқтырған жасушаларда осы сигналдарға жауап беруге қабілетті РНҚ-тәуелді РНҚ полимераза белсенділігі бар.

      W. Miller et al., 1985, Nature 313:68, жабын ақуызы үшін хабар ретінде қызмет ететін RNA4 өндірісі РНҚ3 (-) тізбек молекуласында РНҚ синтезін бастау арқылы жүретінін анықтады. (-) BglII орнында аяқталатын RNA3 тізбегі үлгілері RNA4 инициация алаңының жоғары ағынында шамамен 21 негіз RNA4 өндірісін бағыттай алды (Miller et al. (1985) L. Marsh et al. (1987) Positive Strand RNA Viruses, New York). , Alan R. Liss, Inc., pp.327-336. Бұл зерттеулер және R. French және т.б. (1986) Science 231:1294 зерттеуі, жоюлар мен кірістірулер SalI сайтында немесе төменгі ағынында екенін көрсетеді. бастапқы алаңның төменгі ағынында шамамен 17 негіз субгеномдық мРНҚ өндірісіне кедергі жасамайды.Француз және басқалар, 1986, субгеномдық жол арқылы сәйкес енгізілген бөгде гендердің экспрессиясын көрсетті.Осылайша, BMV субгеномдық промотор белсенділігі 37-ге локализацияланған деп есептелді. cDNA клонында BglII және SalI учаскелерінің арасында орналасқан базалық аймақ.Марш және басқалар (1987) сонымен қатар BMV субгеномдық промотор белсенділігінің 5' шекарасы BglII сайтынан жоғары емес екенін in vitro эксперименттерінен дәлелдеді. RNA4 бастау алаңынан жоғары 21 негіз.Марш және т.б л. (1987) сонымен қатар RNA4 инициация алаңының біршама жоғары жағындағы поли(А) трактінің промотор белсенділігін жақсартқанын дәлелсіз айтты. Миллер және т.б. (1985) және Марш және т.б. (1987) транскрипция талаптарын зерттеу үшін in vitro экспрессия эксперименттерін пайдаланған, олардың нәтижелері нуклеотидтер тізбегі туралы ақпараттың -95-ке дейінгі жоғары ағынның (+) тізбегі мРНҚ синтезінің деңгейіне ықпал ете алатынын көрсетпеді. Миллер және т.б. (1985) не Марш және т.б. (1987) субгеномдық транскрипцияның белсенділігін хабарлады, өйткені олардың конструкцияларында болжамды промоторға 5' реттілігі жоқ. Бірде-бір жарияланған зерттеу жаңа субгеномдық мРНҚ құру үшін қажетті жаңа орынға ауыстырылуы мүмкін нуклеин қышқылының субгеномдық промоторы бар фрагментін пайдалануды сипаттамады.

      Осы өнертабыс РНҚ-тәуелді РНҚ полимераза арқылы өсімдік тінінде, жануарлар тінінде немесе протистік жасушаларда құрылымдық геннің күшейтілген экспрессиясын бағыттау үшін (+) тізбегі РНҚ вирусының субгеномдық промоторы ретінде қызмет ететін нуклеотидтер тізбегін пайдалануды үйретеді. Бұл өзек аймағын анықтайтын нуклеотидтер тізбегі және (+) вирустың субгеномдық промоторының жоғары ағынды белсендіру домені анықталған бірінші инстанция. Бұл субгеномдық промотор модификацияланған вируста немесе хромосомалық интеграцияланған немесе трансформацияланған жасушаларда эпизома ретінде сақталуы мүмкін тиісті түрде жасалған рекомбинантты cDNA туындысында пайдаланылуы мүмкін. Өнертабыс бром-мозаикалық вирусының (BMV) РНҚ-ның субгеномдық промоторымен мысалға келтірілген, бірақ осы өнертабыстың ілімдері білікті шеберге кез келген қажетті жасушада пайдалану үшін ұқсас (+) тізбекті РНҚ вирустарынан субгеномдық промоторлар тізбегін таңдауға және пайдалануға мүмкіндік береді. түрі. BMV субгеномдық промоторы екі бөліктен тұрады: негізгі промотор, суреттегідей шамамен -21-ден +16-ға дейінгі нуклеотидтер тізбегі бойынша анықталған. 2, бұл субгеномдық транскрипцияны бағыттау үшін жеткілікті және белсендіруші домен, суреттегідей шамамен -95-тен -22-ге дейінгі нуклеотидтер тізбегі арқылы анықталған. 2. Белсендіру домені субгеномдық транскрипция деңгейін жоғарылатуға жақсы әсер етеді, егер аталған белсендіруші домен аталған негізгі промотордан жоғары және оған қатысты тиісті бағытта орналасқан. Субгеномдық транскрипция РНҚ-тәуелді РНҚ полимераза белсенділігіне және құрамында субгеномдық промотор мен құрылымдық гені бар (-) тізбекті РНҚ молекуласына тәуелді, мысалы, BMV субгеномдық промоторы РНҚ вирустарымен кодталған РНҚ-тәуелді РНҚ полимераза белсенділігімен танылады, бірақ емес. бром мозаикалық вирусы және сиырдың хлоротикалық ала вирусымен шектелген. Қолданыстағы өнердегі одан әрі жақсартулар субгеномдық промотордың белсендіру доменінің жоғары ағынды қайталануы субгеномдық транскрипцияның бір көшірме субгеномдық промотор басқаратын деңгейге қарағанда жоғарылауы мүмкін және субгеномдық промотордың бірнеше көшірмелері бірден көп синтезін басқара алады. бір (-) тізбекті РНҚ үлгісінен субгеномдық мРНҚ молекуласы.

      Өнертабыстың негізгі мақсаты (+) тізбегі РНҚ вирусының субгеномдық промоторының ДНҚ көшірмесін және аталған геннің экспрессиясы екі сатылы процесс болып табылатын құрылымдық генді қамтитын рекомбинантты ДНҚ молекуласын қамтамасыз ету болып табылады: хосттың поли II. жасуша субгеномдық промотордың функционалды тізбегін және аталған құрылымдық геннің комплементарлы тізбегін тасымалдайтын (-) тізбекті РНҚ молекуласын транскрипциялайды, мұнда хабарды сезетін РНҚ синтезі аталған субгеномдық промотордың бақылауында болады. Бір нұсқада бром-мозаикалық вирустың РНҚ3 субгеномдық промоторы төменгі құрылымдық геннің экспрессиясын басқарады. Генетикалық түрлендірілген өсімдік ұлпасының РНҚ полимераза II РНҚ молекуласын синтездейді, ол (-) мағыналы, субгеномдық промотордың функционалды көшірмесі және құрылымдық геннің (-) сезімдік көшірмесі. РНҚ-тәуелді РНҚ полимераза, BMV вирустық РНҚ репликазы болуы мүмкін, субгеномдық промоторды таниды және (+) мағынаны немесе функционалды хабар-сезімді РНҚ молекуласын синтездейді, ол кейіннен белокқа аударылуы мүмкін. (-) тізбегіндегі РНҚ молекуласындағы BMV субгеномдық промоторына жауап беретін РНҚ-тәуелді РНҚ-полимераза белсенділігі бром-мозаикалық вирусынан немесе сиыр бұршақтарының хлоротикалық ала вирусының генетикалық ақпаратынан немесе рекомбинантты ДНҚ молекуласынан, мысалы, 1a және кодтауынан болуы мүмкін. BMV 2a гендері, мұнда аталған гендер конститутивтік промоторға жауап ретінде немесе өсімдік реттеуші элементінің реттеуші бақылауымен иесі жасушаның РНҚ-полимераза II арқылы транскрипциядан кейін ақуызға айналуы мүмкін.

      Өнертабыстың келесі мақсаты - (+) тізбегі РНҚ вирусының субгеномдық промоутері және құрылымдық вирустың субгеномдық промоутері бар рекомбинантты ДНҚ молекуласын қажетті хост жасушасына енгізу қадамдарынан тұратын трансформацияланған жасушаларда күшейтілген ген экспрессиясының әдісін қамтамасыз ету. геннің экспрессиясы субгеномдық промотордың реттеуші бақылауында болатын және бұл геннің экспрессиясы субгеномдық промотордың белсенді түрін тасымалдайтын (-) тізбекті РНҚ молекуласын алу үшін II иесі жасушалық РНҚ полимеразасының транскрипциясына байланысты болатын ген. активті алу үшін геннің кейінгі субгеномдық транскрипциясы, (+) РНҚ-тәуелді РНҚ полимераза белсенділігі арқылы мРНҚ-ны сезіну, содан кейін құрылымдық генмен кодталған полипептидті өндіру үшін субгеномдық транскрипттің трансляциясы. Хост поли II транскрипциясын конститутивтік, индукцияланатын немесе басылмайтын поли II промоторы басқара алады.

      Суреттерде және бүкіл қолданбада субгеномдық промотор болып табылатын тізбектер белсенді субгеномдық промотор тізбегінің толықтыруы ретінде түсінілетін (+) тізбекті тізбектер ретінде ұсынылған.

      ЦИУРАТТАРДЫҢ ҚЫСҚА СИПАТТАМАСЫ

      ІНЖІР. 1 BMV RNA3 схемалық картасын ұсынады. Кодталмаған аймақтар бір жол ретінде, 3a және қабық гендер ашық жәшіктер ретінде, олиго(A) шағын толтырылған қорап ретінде және майысқан көрсеткі субгеномдық RNA4 кодтайтын тізбектердің басталу орнын белгілейді. Жалпы тәжірибеге сәйкес, оралған (+) тізбектің тізбегі көрсетілген, бірақ комплементарлы тізбек субгеномдық РНҚ синтезі үшін үлгі ретінде қызмет ететінін атап өткен жөн. Бұл суретте нөмірлеу және күріш. 3, 4, 5 және 6, келесі сандар, RNA3 үшін жарияланған реттілікке сәйкес келеді (P. Ahlquist et al. (1981) J. Mol. Biol. 153:23). Рестрикциялық эндонуклеаза учаскелері RNA3 тізбегін тасымалдайтын кДНҚ молекулаларында танылады.

      ІНЖІР. 2 бром-мозаикалық вирусы RNA3 кДНҚ клонына сәйкес келетін РНҚ AvaI-SalI фрагментінің нуклеотидтер тізбегін көрсетеді, оның фрагменті BMV субгеномдық промоторының тізбегін және (-) тізбегіндегі РНҚ молекуласындағы субгеномдық транскрипцияның бастау алаңын қамтиды. . Көрсетілген шектеу орындары сәйкес cDNA-ға арналған. Көрсетілген реттіліктерде ядро ​​промоторын шектейтін AvaI, BglII және SalI учаскелері сызылған және пальто протеинін бастау кодоны мен олиго(A) трактісі асты сызылған. Иілген көрсеткі субгеномдық транскрипттің (RNA4) басталуын белгілейді және қақпақпен жабылған RNA4 молекуласының 5' соңының реті берілген.

      ІНЖІР. 3. pB3TP8 (жабайы типті), pB3SG5 және pB3SG6 плазмидаларындағы цДНҚ қабық генін қоршайтын аймақтардың схемалық диаграммасы. pB3SG5-те көшірілген AvaI-SacI фрагменті жабайы типтегі реттілікке жақшаға салынған және pB3SG5 және pB3SG6 ішіндегі жаңа орындарында көлеңкеленген. Субгеномдық РНҚ 4 және 4' үшін бастау орындары иілген көрсеткілермен көрсетілген. pB3SG5 және pB3SG6 үшін RNA4':RNA3 қатынасы тиісінше 2,4 және 3,3 болды. Жабайы типті плазмида және pB3SG5 үшін RNA4 :RNA3 қатынасы тиісінше 1,2 және 0,4 болды.

      ІНЖІР. 4. Субгеномдық промоторлардың белсенділігіне 5' жоюдың әсері. pB3SG5 туындысындағы 3' проксимальды РНҚ инициация аймағын қоршап тұрған реттілік және pB3SG21, 22 және 15 туындыларындағы жойылулар картасы. pB3SG11 - жойылмаған тізбектерді көрсететін плазмида. RNA4':RNA3 молярлық қатынасы үшін берілген мәндер екі немесе одан да көп тәуелсіз эксперименттердің орташа мәні болып табылады.

      ІНЖІР. 5. Субгеномдық промоторлардың белсенділігіне жоғары ағындық қайталанулардың әсері. Жабайы типтегі RNA3 (масса) және RNA3 туындыларында қайталанған реттіліктердің интерцистрондық аймағының картасы pB3IC2, 5 және 6. Осы туындылардың әрқайсысында интерцистрондық тізбектің көрсетілген сегменті көшірме ретінде бірден 1015 позициясына 5' енгізіледі. RNA3 тізбегі. RNA4':RNA3 молярлық қатынасы үшін берілген мәндер үш тәуелсіз эксперименттің орташа мәні болып табылады. Салыстыру үшін, RNA4': RNA3 қатынасы жоғары ағынды ақпараттың қайталануысыз алынған ұқсас конструкциялар үшін әдетте шамамен 2,4 құрайды.

      ІНЖІР. 6. Жеке RNA3 туындыларынан бірнеше субгеномдық транскрипттерді алу. RNA3 туындыларының схемалық карталары pB3SG5, 7, 9, 10, 13 және 14. Әрбір жолдағы ашық көрсеткілер RNA4 бастау алаңын қамтитын AvaI-SacI фрагментінің қосымша көшірмелерін кірістіру орындарын көрсетеді. Әрбір көрсеткінің үстінде сол субгеномдық РНҚ-ның екі немесе одан да көп тәуелсіз эксперименттердің орташа алынған геномдық RNA3 туындысына молярлық қатынасы берілген. Әрбір мән көрнекі салыстыру үшін гистограмма жолағы ретінде де ұсынылады. Толтырылған бастары бар көрсеткілер оның жабайы түрдегі контекстінде өзгертілмеген RNA4 промоутерін білдіреді. Осы жағдайларда жабайы типті инфекциядағы субгеномдық РНҚ4-тің геномдық РНҚ3 өндірісіне орташа қатынасы 1,2 құрайды.

      ІНЖІР. 7(A). BMV RNA3 AvaI-SalI тізбегін туралау, жетілмеген тікелей қайталанулардың болуын баса көрсету. Бұл талдау компьютердің көмегімен жүргізілді. BglII-SalI негізгі промоторлар тізбегі көрсетілген қатты қорапта көрсетілген. SalI учаскесін қабаттасатын пальто бастау кодоны да белгіленген.

      ІНЖІР. 7(B). Капсид белоктары үшін субгеномдық мРНҚ кодтайтын тізбектердің басталуына жақын BMV, жануар альфавирустары, сиырдың хлоротикалық ала вирусы (CCMV) және жоңышқа мозаикалық вирусы (ALMV) геномдық РНҚ арасындағы ұқсастықты көрсететін реттілік туралау. Альфавирус консенсус тізбегіне сәйкес келу үшін ғана енгізілген әрбір өсімдік вирусының тізбегінде үлкен бос орын бар. Иілген көрсеткі субгеномдық РНҚ реттерінің басталуын көрсетеді және BMV және CCMV пальто ақуыз гендерінің инициациялық кодондарының асты сызылған. Бұл теңестірулер нақты субгеномдық промотор эмпирикалық түрде анықталған BMV вирусынан басқа ешбір вируста жарияланған реттіліктерді пайдаланып компьютер арқылы жасалды. Альфавирус консенсусы Sindbis, Middelburg, Semliki Forest және Ross River вирустарының тізбегінен алынған (J.-H. Ou et al. (1982) Proc. Natl. Acad. Sci. USA 79:5235). ALMV RNA3 тізбегі R. Barker және т.б. (1983) Nuclein Acids Res. 11:2881 және CCMV RNA3 реттілігін P. Ahlquist et al. (1981) 23:183 ұяшығы.

      ІНЖІР. 8 күшейтілген транскрипция үшін субгеномдық промоторды пайдаланатын екі сатылы экспрессиялық жүйенің қалыпты РНҚ вирусының репликациясының схемалық кескіндерін ұсынады.

      ІНЖІР. 8А хост жасушаларының қалыпты инфекциясында вирустық РНҚ күшейтетін дәйекті (-) және (+) тізбекті синтезінің схемасын береді.

      ІНЖІР. 8В вирустық субгеномдық промотордан бірнеше комплементарлы көшірмелердің цитоплазмалық синтезі арқылы хромосомалық транскриптті ұқсас күшейту схемасын береді. Трансляцияланбайтын бастапқы транскрипт, оның өзі өсімдік экспрессивті генінің кодтау тізбегіне қатысты (-) тізбек болып табылады, полII промоторына жауап ретінде жасушалық РНҚ полимераза II арқылы синтезделеді. РНҚ-тәуелді РНҚ-полимераза белсенділігі, мысалы, BMV 1a және 2a гендерімен индукцияланған, бастапқы (-) тізбекте белсенді түрде болатын субгеномдық промоторлар тізбегі арқылы бағытталған (+) сезімдік мРНҚ субгеномдық транскрипциясына қол жеткізу үшін қажет. транскрипт РНҚ молекуласы. Өсімдік ұлпасы РНҚ-полимераза II реттеуші бақылауындағы РНҚ-тәуелді РНҚ-полимераза белсенділігін кодтайтын ген(дер)ді қамту үшін генетикалық түрлендірілуі мүмкін немесе бұл белсенділік вирустық инфекция кезінде көрінуі мүмкін. Бастапқы транскрипттің полярлығы оның субгеномдық РНҚ өніміне қарама-қарсы болғандықтан, сәйкес бағытталған гендердің трансляциясы тек қайталама субгеномдық транскрипттен жүзеге асады. Осылайша, бұл схема индукцияны, сондай-ақ күшейтетін өрнекті басқаруды қамтамасыз етеді.

      ӨНЕРБІШТІҢ ТОЛЫҚ СИПАТТАМАСЫ

      Төмендегі анықтамалар спецификациядағы және шағымдардағы оларды қолдану ауқымындағы түсініксіздіктерді жою үшін берілген.

      Осы құжатта пайдаланылған РНҚ вирусы геномы бір тізбекті РНҚ болып табылатын, бір тізбек (+) немесе хабаршы-сезім тізбегі болып табылатын вирусты білдіреді. Жасушадағы вирустық (+) тізбегінің репликациясы тікелей РНҚ репликациясының процесі арқылы жүреді және сондықтан иесі жасушадағы кері транскрипцияның аралық сатысымен сипатталатын ретровирустық репликация механизмінен ерекшеленеді.

      Субгеномдық промотор термині РНҚ молекуласының ішіндегі және құрылымдық геннің 5' соңындағы тізбектерді білдіреді, олар РНҚ молекуласын үлгі ретінде пайдалана отырып хабаршы РНҚ синтезін басқарады. Субгеномдық промотор РНҚ көмегімен гендердің экспрессиясын жүргізу үшін қажет, субгеномдық промоторды РНҚ-тәуелді РНҚ полимераза таниды, ол вирустық РНҚ репликазасы болуы мүмкін. Промотордың өзі табиғи немесе синтетикалық бірнеше көздерден алынған сегменттердің композициясы болуы мүмкін. Субгеномдық промотор транскрипциясы басталатын белгілі бір генге қатысты орналасқанын және ол тиісті РНҚ молекуласының құрамында болған кезде РНҚ-тәуелді РНҚ полимераза (немесе вирустық РНҚ репликазасы) арқылы функционалды түрде танылатынын атап өткен жөн. (-) полярлық. Негізгі промотордың және белсендіру доменінің функционалдық бірліктерін қамтитын субгеномдық промотордың функционалды көшірмесін қамтитын (-) сезгіш РНҚ молекуласы үлгі ретінде (+) сезгіш РНҚ молекуласын пайдаланып РНҚ-тәуелді РНҚ полинеразамен синтезделеді немесе ол ПолII промоторы бастаған транскрипт ретінде (жасушалық) РНҚ полимераза II арқылы синтезделген болуы мүмкін. Осы өнертабыстың нақты нұсқасы бром-мозаикалық вирусының (BMV) RNA3 субгеномдық промоторы болып табылады. BMV субгеномдық промоторының сәйкестендіру тізбегі суретте келтірілген. 2. Осы құжатта келісімді болу үшін бром-мозаикалық вирустың субгеномдық промоторының орны +1 деп белгіленген субгеномдық мРНҚ-ның бастапқы орнына қатысты берілген. BMV субгеномдық промоторы суреттегідей шамамен -95-тен +17-ге дейін созылатын нуклеотидтер тізбегін қамтиды. 2 шамамен -74-тен +16-ға дейінгі аймақта тұратын тізбек те функционалды субгеномдық промоторды құрайды.

      Субгеномдық промотордың негізгі промоутері функция үшін қажетті ең аз ретті қамтиды. BMV жағдайында негізгі промотор суреттегідей шамамен -21-ден +17-ге дейінгі нуклеотидтер тізбегін қамтиды. 2. Техникада түсінілетіндей дұрыс орналастырылған кезде, ядро ​​​​промоторы (+) тізбекті РНҚ молекулалары синтезделу үшін РНҚ-тәуелді РНҚ полимераза арқылы хабарлама синтезінің инициациясын бағыттау үшін жеткілікті.

      Субгеномдық промотордың белсендіру домені субгеномдық транскрипттердің синтезін арттыруға мүмкіндік беретін негізгі промотордың белсенділігін арттыратын тізбектерді қамтиды. BMV жағдайында субгеномдық промотор немесе субгеномдық өзек промоторы басқаратын мРНҚ синтезін арттыра алатын белсендіру домені тек негізгі промоторлар тізбегі болған кезде алынған деңгейлерге қатысты шамамен -95 пен арасындағы нуклеотидтер тізбегін қамтиды. шамамен -22, суреттегідей. 2. Шамамен -74-тен -22-ге дейінгі дәйектілікпен белсендіру біршама азырақ алынады.

      РНҚ-ға тәуелді РНҚ-полимераза бұл жерде субгеномдық промотор болып табылатын РНҚ тізбегіне жауап ретінде (+) тізбекті РНҚ синтезін бастайтын және кодтауға қатысты (-) мағынасы бар РНҚ молекуласының құрамында болатын РНҚ синтетикалық ферментіне қатысты. байланысты құрылымдық геннің аймағы. Мысалы, BMV-нің 1a және 2a гендері сол гендер экспрессияланатын жасушалардағы РНҚ-тәуелді РНҚ-полимераза белсенділігін анықтайды және РНҚ-тәуелді РНҚ-полимераза белсенділігі субгеномдық промоторларды таниды, бірақ олармен шектелмей, бром мозаикалық вирусы және сиырдың хлоротикалық ала вирусы.

      Субгеномдық транскрипция термині бұл жерде РНҚ-ға тәуелді РНҚ-полимераза арқылы РНҚ синтезіне жатады, мұнда аталған РНҚ-тәуелді РНҚ полимераза үлгі ретінде РНҚ-ның (-) тізбегін пайдаланады және аталған РНҚ-ға тәуелді РНҚ-полимеразада мРНҚ синтезін бастайды. субгеномдық промоторда қамтылған нуклеотидтер тізбегі туралы ақпаратқа жауап.

      (+) тізбекті РНҚ термині кодтау аймақтарына қатысты хабаршы-сезімге ие РНҚ-ға қатысты.

      (-) сезгіш РНҚ термині (+) сезім молекулаларының комплементі болып табылатын тізбектерді білдіреді. Мысалы, құрылымдық генге сәйкес келетін (-) сезімдік РНҚ молекуласы хабарламаның реттілігі бойынша комплементарлы болады, ал (-) сезгіш РНҚ молекуласының өзі сәйкес ақуызды трансляциялау үшін хабарлама қызметін атқара алмайды.

      Мұндағы polII промоторы термині өсімдіктер немесе жануарлар жасушаларының ДНҚ-тәуелді ферменті РНҚ полимераза II арқылы транскрипция инициациясын басқаратын гендердің 5' соңындағы ДНҚ тізбегіне қатысты. Төменгі гендердің экспрессиясын жүргізу үшін промотерлік тізбектер қажет, бірақ әрқашан жеткілікті емес. Промотордың өзі табиғи немесе синтетикалық бірнеше көздерден алынған сегменттердің композициясы болуы мүмкін. Эукариоттық поли II промоторлары әдетте канондық 5'--TATAA--3' («TATA» қорабы) 5'-ұшының орналасуына шамамен 10-30 bp 5'-ге гомолог ДНҚ тізбегінің болуымен анықталады. мРНҚ (қақпақ алаңы, +1). TATA қорапшасына шамамен 30 bp 5' басқа промотор құрамдас бөлігі жиі кездеседі, бірақ әрқашан емес, ол 5'-CCAAT -3' канондық формасына гомолог ДНҚ тізбегінің болуымен анықталады. Осы сипаттаманың мақсаттары үшін полII промоторы қақпақ аймағына дейін шамамен 100 bp 5'(-100) дейін созылатын ДНҚ тізбегін қамтитындай анықталған. 5'-ден -100-ге дейін орналасуы мүмкін және транскрипцияны белсендіретін элементті немесе қоршаған ортаның стимулдарына жауап ретінде реттеуді жүзеге асыратын тізбектерді қоса, бірақ олармен шектелмей функционалдылықты қамтуы мүмкін кез келген қосымша тізбектер промоторлармен байланысты элементтер болып саналады, бірақ олар үшін аталған реттіліктерді ДНҚ-тәуелді РНҚ-полимераза II-ден басқа жасушалық ақуыздар тануы мүмкін болса да, осы қолданбаның мақсаттары полII промоторының бөлігі болып саналады. (Полимераза белгілі бір ДНҚ тізбегін «танады» деп аталады, егер бұл реттілік полимераза арқылы транскрипцияны бастау үшін қажет болса немесе реттеуші әсер етеді.) ПолII промоторы әдетте белгілі бір геннің 5' қашықтықта орналасқанын ескеру қажет. ол транскрипцияны бастайды. Бұл транскрипт хабарлама ретінде қызмет ете алатын (+) мағыналы РНҚ молекуласы немесе кейінгі РНҚ синтезі үшін үлгі бола алатын (-) тізбекті РНҚ молекуласы болуы мүмкін.

      Экспрессия құрылымдық геннің белок жасалуы үшін транскрипциясы мен трансляциясын білдіреді. Геннің экспрессиясын ақуыз өнімін тікелей анықтау арқылы, мысалы, протеинді гель электрофорезі немесе иммунологиялық әдістер арқылы бағалауға болады. Көбінесе экспрессия транскрипцияның мРНҚ өнімдерін анықтау арқылы бағаланады. Бұл әдіс әсіресе промотор элементтері сияқты транскрипциялық бақылау факторларын бағалау үшін қолайлы, өйткені белоктың ыдырауы сияқты транскрипциялық емес процестердің әсері жоққа шығарылады.

      Құрылымдық ген ақуызды кодтайтын нуклеотидтер тізбегі мен (кейбір) өсімдік жасушасында немесе ұлпасында осы құрылымдық геннің экспрессиясына мүмкіндік беретін реттеуші реттіліктердің тіркесімін білдіреді. Құрылымдық ген термині белокты, полипептидті немесе оның бөлігін кодтайтын ДНҚ сегментінен тұратын геннің бөлігін білдіреді, мүмкін рибосоманы байланыстыру орнын және/немесе трансляциялық бастапқы кодонды қамтиды. Бұл термин сонымен қатар жасуша ішінде табиғи түрде табылған, бірақ жасанды түрде енгізілген құрылымдық геннің көшірмелеріне де қатысты болуы мүмкін. Бұл жағдайда жасушада табиғи түрде табылған құрылымдық ген, мысалы, BMV субгеномдық промоторының бақылауымен табиғи емес реттеуші реттіліктері бар химерлі геннің бөлігі ретінде жасушаға қайта енгізілуі мүмкін. Құрылымдық ген әдетте ген енгізілген өсімдік жасушасында кездеспейтін ақуызды кодтай алады, бұл жағдайда ол бөгде құрылымдық ген деп аталады. Бөтен құрылымдық ген толығымен немесе ішінара бактериалды геномнан немесе эписомадан, эукариоттық ядролық немесе пластидтік ДНҚ-дан, кДНҚ-дан, вирустық ДНҚ-дан немесе химиялық жолмен синтезделген ДНҚ-дан алынуы мүмкін. Бұдан әрі құрылымдық ген кодтау сегменттерінде немесе трансляцияланбаған аймақтарда бір немесе бірнеше модификацияларды қамтуы мүмкін, олар экспрессия өнімінің биологиялық белсенділігіне немесе химиялық құрылымына, экспрессия жылдамдығына немесе экспрессияны басқару тәсіліне әсер етуі мүмкін. . Мұндай модификацияларға бір немесе бірнеше нуклеотидтерді енгізу, жою және алмастыру кіреді, бірақ олармен шектелмейді. Құрылымдық ген үзіліссіз кодтау тізбегін құрауы мүмкін немесе ол иесінің жасуша-функционалды қосылыстарымен шектелген бір немесе бірнеше интрондарды қамтуы мүмкін. Құрылымдық ген табиғи немесе синтетикалық көптеген көздерден алынған сегменттердің композициясы болуы мүмкін. Бұл құрылымдық ген синтез протеинін де жасай алады. Құрамында құрылымдық гені бар рекомбинантты ДНҚ-ны субгеномдық промотормен немесе полII промоторымен біріктірілген қожайын жасушаларына енгізу құрылымдық ген иесі сияқты жасуша түрінен алынбайтын конструкцияларды және конструкцияларды қамтитыны қарастырылады. мұнда табиғи түрде кездесетін гендердің қосымша көшірмелері BMV субгеномдық промоторының бақылауымен экспрессияланады.

      Рекомбинантты ДНҚ молекуласы – гетерологиялық көздерден алынған бөліктерден табиғи немесе жасанды түрде өндірілген, оның бөліктері табиғи түрде кездесетін немесе химиялық жолмен синтезделген молекулалар болуы мүмкін және бұл бөліктер байлау арқылы немесе техникада белгілі басқа әдістермен біріктірілген.

      Өсімдік ұлпасына өсімдіктердің дифференциалданған және дифференциацияланбаған ұлпаларын, соның ішінде, бірақ олармен шектелмей, тамырларды, өркендерді, жапырақтарды, тозаңдарды, тұқымдарды, тәж тәрізді ісік ұлпаларын және эмбриондар мен калли сияқты культурадағы өсімдік жасушаларының агрегацияларының әртүрлі формаларын қамтиды. Өсімдік ұлпасы плантада немесе органда, ұлпада немесе жасуша мәдениетінде болуы мүмкін.

      ДНҚ тізбегіне қатысты химиялық жолмен синтезделген термині компонент нуклеотидтері ферментативті емес құралдарды қолдану арқылы in vitro жинақталғанын білдіреді. ДНҚ-ны қолмен синтездеу жақсы бекітілген процедураларды қолдану арқылы жүзеге асырылуы мүмкін (яғни, М. Карутерс (1983) DNA және RNA Sequencing Methodology in Weissman (ed.), Praeger Publishers (Нью-Йорк) 1 тарау) немесе автоматтандырылған синтез біреуін қолдану арқылы орындалуы мүмкін. бірқатар коммерциялық қол жетімді машиналар.

      Мұнда қолданылған гомология нуклеотидтер тізбегінің сәйкестігін білдіреді. ДНҚ тізбегі арасындағы гомологияның дәрежесін ДНҚ будандастыру эксперименттерінде эмпирикалық түрде анықтауға болады, мысалы, B. Hames және S. Higgins (1985) Nuclein Acid Hybridisation, IRL Press, Oxford, UK.

      BMV RNA3-де тасымалданатын тізбектерге қатысты біршама икемділік болғандықтан, интерцистрондық аймақтағы белгілі бір РНҚ тізбегі субгеномдық промоторлық белсенділікке қалай ықпал еткенін зерттеуге болады. Субгеномдық РНҚ синтезін бастау үшін бастапқы орыннан төмен қарай 16 негізден артық қажет емес екені белгілі болды (яғни вириондық РНҚ-дағы RNA4 тізбегінің басталуына дейін 3') (W. Miller et al. (1985) Nature 313 :68 R. French et al. (1986) Science 231:1294 L. Marsh et al. (1987) in Positive Strand RNA Viruses, Alan R. Liss, Inc., New York, pp.327-336). Инженерлік RNA3 cDNA клондарынан синтезделген инфекциялық in vitro транскрипттері RNA3-тің бастапқы құрылымындағы өзгерістердің әсерін анықтау үшін пайдаланылды. BMV RNA3 кДНҚ клонының шектеу картасы және субгеномдық транскрипцияның басталу орындарын қоршап тұрған AvaI-SalI аймағының нуклеотидтер тізбегі суретте келтірілген. 1 және 2.Субгеномдық хабарламаның басталу алаңынан жоғары қарайғы тізбектің маңызды ерекшелігі бромовирус тобының басқа мүшелерінде баламалы геномдық позицияларда сақталған олиго(A) трактісі (P. Ahlquist et al. (1981) 23:183 ұяшық жарияланбаған бақылаулар). ). Олиго(А) трактінің субгеномдық промоторлық белсенділікке әсер ететінін анықтау үшін бір А қалдығынан басқасы жоқ pB3IC4 мутантты плазмидасы жасалды. In vitro RNA3 транскрипті in vivo ата-аналық субгеномдық промотор белсенділігінің 10%-дан азына ие болды. Олиго(А) трактінің ұзындығы табиғи RNA3 популяцияларында 16-22 аралығында болады (P. Ahlquist et al. (1981) J. Mol. Biol. 153:23). pB3TP8-де 18 А қалдығы бар (M. Janda et al. (1987) Virology 158:259). Олиго(A) трактісі бар субгеномдық промоторлар суреттегідей ұзындығы 18-ден ерекшеленеді. 2, суреттегі BMV субгеномдық промоторына функционалды баламалы болып саналады. 2, олиго(A) жанындағы жүйелі ақпараттың ұқсас көлемі сақталған жағдайда.

      Сынақ жүйесінде ата-аналық RNA3 транскрипттері 1,2 RNA4:RNA3 қатынасында ұрпақ (+) тізбекті РНҚ өндірді. Интерцистрондық аймақтағы реттілік өзгерістерінің субгеномдық хабарды өндіруге әсерін геномдық RNA3 күшейту әсерінен бөлу үшін, RNA3 cDNA-ның XbaI орнында бастапқы алаңды қамтитын cDNA-ның AvaI-SacI фрагментін енгізу арқылы екінші субгеномдық инициация орны құрылды. pB3SG5 жасау үшін (Cурет 3). pB3SG5 транскрипттері репликацияланды және мақсатқа сай екі субгеномдық РНҚ синтезін бағыттады. Субгеномдық промотордың (RNA4') құрастырылған көшірмесінен алынған субгеномдық мРНҚ жабайы типтегі субгеномдық промотордан шыққан геномдық RNA3 және субгеномдық мРНҚ-ға қарағанда көбірек болды. RNA4':RNA3 қатынасы 2,4:1 pB3SG5 алынды. pB3SG5-пен бірдей дистальды жерде субгеномдық промотордың бір ғана көшірмесін қамтитын pB3SG6 2,5:1 қатынасында субгеномдық және геномдық РНҚ өндірді.

      pB3SG5 және pB3SG6 көмегімен алынған субгеномдық РНҚ түрлерінің өлшемдері қайталанатын промоторлар тізбегіндегі күтілетін орындардан бастауға сәйкес болды. Праймерді ұзарту эксперименттері субгеномдық РНҚ синтезінің бастау орнының тіпті субгеномдық промотор жаңа орынға жылжытылғанда немесе RNA3 cDNA клонында қайталанған кезде де өзгермейтінін растады. Жабайы типтегі RNA4 (R. Dasgupta et al. (1976) J. Virol. 18:260) сияқты, жаңа субгеномдық РНҚ инициация алаңынан жасалған субгеномдық РНҚ жабылды.

      Субгеномдық РНҚ бастау алаңының жоғары ағынындағы аймақтағы РНҚ тізбектерінің одан әрі функционалдығы өсімдік тініндегі субгеномдық мРНҚ синтезіне ішкі кірістіру және жою мутацияларының сериясының әсерін анықтау арқылы зерттелді. Екінші функционалды субгеномдық промотор интерцистрондық аймақтың дисталында орнатылды, сондықтан толық ұзындықтағы RNA3 жинақталуына елеулі әсер етпестен субгеномдық РНҚ синтезіне ықпал ететін тізбектердің 5' шегін зерттеу үшін жою талдауын қолдануға болады. Протопласт инфекцияларында бұл жоюлар субгеномдық РНҚ өндірісінің айқын үдемелі төмендеуіне әкелді, өйткені делециялар одан әрі 5' ұзарды. Азайған жинақтау синтездің төмендеуін көрсетуі керек, өйткені субгеномдық РНҚ тізбегі, демек, оның тұрақтылығы әртүрлі құрылымдарда өзгеріссіз қалды. Нәтижелер суретте жинақталған. 4. pB3SG11 құрамында шамамен 95 негіз бар AvaI-SalI фрагментін субгеномдық транскрипцияның басталуынан төмен қарай шамамен 16 негізден жоғары ағынмен тасымалдады. RNA4':RNA3 2,5 қатынасы pB3SG5 қатынасына ұқсас болды, ол реттілік туралы ақпаратты SacI учаскесі арқылы жабын ақуыз геніне жақсы тасымалдады. PB3SG21, BstXI учаскесінен шамамен -74 субгеномдық промоторлар тізбегін қамтитын SalI учаскесі арқылы бастапқы алаңның төменгі ағынында, RNA4':RNA3 арақатынасын жабайы типті плазмиданың RNA4:RNA3 қатынасына ұқсас, бірақ pB3SG11-тен төменірек құрады. . Жоғары ағынды аймақтың одан әрі жойылуы RNA4':RNA3 қатынасының одан әрі төмендеуіне әкелді. pB3SG15 ең қысқа субгеномдық промотор фрагменті (BglII-SalI) бар плазмида болды, RNA4':RNA3 қатынасы 0,3:1 болды, бұл кесілген субгеномдық промотордың тиімділігі шектеулі екенін көрсетті. Осылайша, негізгі промотордың 5' ұшы -21-ден 5'-ден артық емес және тиімді инициация үшін қажетті барлық ақпарат 3'-тен -95-ке дейін, нәтижелер тек шамамен 74 болғанда жабайы типті плазмидтік қатынасқа ұқсас. жоғары ақпараттың негізі бар. Сондықтан BglII-SalI фрагменті, суреттегідей шамамен -21-ден +16-ға дейін. 2, BMV субгеномдық негізгі промоторынан тұрады. AvaI-SalI фрагменті, шамамен -95-тен +16-ға дейін, суреттегідей. 2 және BstXI-SalI фрагменті, шамамен -74-тен +16-ға дейін, суреттегідей. 2, екеуі де субгеномдық промотордың белсендіру доменін және негізгі промоторлық әрекеттерін қамтиды.

      Субгеномдық транскрипция үшін бастапқы тораптан 220 негізге жоғары орналасқан жерде RNA3 интерцистрондық аймағынан субгеномдық промоторды белсендіретін домен тізбектерінің қайталануы субгеномдық РНҚ синтезінің стимуляциясына әкелді. Жабайы типті және мутантты плазмидалар үшін құрылымдар мен RNA4:RNA3 қатынасы суретте келтірілген. 5. Субгеномдық РНҚ синтезінің маңызды стимуляциясына РНҚ басталу алаңының жоғарғы жағындағы РНҚ3 кДНҚ-ның -95-тен шамамен -21-ге дейінгі AvaI-BglII фрагменті, белсендіру доменінде қамтылған дәйектілікті көбейту арқылы қол жеткізілді. Олиго(A) трактісі бұл ынталандыруға үлес қосқанымен, ынталандырудың пайда болуы үшін қажет емес.

      AvaI-SacI фрагменті болған кезде XbaI сайтынан басқа сайттар субгеномдық РНҚ синтезіне қолдау көрсете алатынын анықтау үшін RNA3-тің AvaI-SacI фрагменті ClaI 5' орнында pB3SG7-дегі қалыпты RNA4 бастапқы орнына көшірілді. Субгеномдық промоторлардың екеуі де функционалды болды және субгеномдық промотордың екі көшірмесі болған басқа жағдайларда сияқты, кіші субгеномдық РНҚ көбірек болды. Мутантты RNA3 cDNA клондары да бір RNA3 туындысында екіден астам субгеномдық промоторлардың функционалдығын тексеру үшін құрастырылды. pB3SG9 және pB3SG10 әрқайсысында екі AvaI-SacI субгеномдық промотор фрагменттері бар, ал pB3SG13 және pB3SG14 әрқайсысында үшеу. Субгеномдық промотор сыналған әрбір жерде белсенді екені анықталды және осы эксперименттерде 3' проксимальды учаскелерден субгеномдық РНҚ-ның көбірек жинақталуына ықпал ететін айқын градиент байқалды (6-сурет). Субгеномдық транскрипцияның байқалған белсенділенуі субгеномдық промотор компоненттерінің жоғары ағымдық қайталануының салдары болып табылады.

      Субгеномдық промотор фрагментінің қоршаған cDNA-ға қатысты кері бағытта жұмыс істеу қабілеті pB3SG5R және pB3SG6R-де сыналған. Ешқандай болжамды субгеномдық РНҚ түрлері байқалмады. Екі жағдайда да инверсия RNA3 жинақталуының ауыр тежелуіне әкелді. 26 б төңкерілген қайталануы бар SG6R үшін авторрадиографтардың шамадан тыс экспозициясында RNA3-тің аз ғана мөлшерін анықтауға болады, бірақ 330 бит инверттелген қайталануы бар SG5R ешқашан анықталатын RNA3 өндірісін бермеді. Ешбір конструкциядан теріс полярлықтың ішкі инициаторлы «псевдо-субгеномдық» РНҚ түрлері анықталмады.

      Компьютер көмегімен дәйектілікті тексеру RNA3 cDNA-ның 120 базалық AvaI-SalI аймағының негізгі промоторы мен субгеномдық промотордың белсендіру доменін қамтитыны бірнеше жетілмеген тікелей қайталауларды қамтитынын анықтады (Cурет 7). Олиго(A) трактіне бір-бірін жабатын және бірден 5' 30 негіз BglII-SalI негізгі промотор аймағымен 67% сәйкестікке ие, бұл қайталанудың 3' шекарасы жабын ақуызын кодтау аймағының басына дәл сәйкес келеді. Осы көшірменің бірден 5' - анық қатысты сегмент, ол сондай-ақ 5'--AUCUAUGUU--3' консенсус элементінің бір сәйкессіздікті қайталауын қамтиды. Осылайша, AvaI-SalI промоутер аймағының барлығы дерлік олиго(A) арқылы бір аймақта пунктуацияланған негізгі промоторға қатысты реттіліктердің қайталануларынан немесе ішінара қайталануларынан тұрады. Кезектілігі ұқсас болғанымен, олиго(A) жанындағы негізгі промотор мотивінің екі данасы бір-біріне сәйкес келмеді. 3' көшірмеде әлсіз, бірақ функционалды промотор болса, осы мотивтің 5' көшірмесіндегі сәйкес жерде субгеномдық РНҚ инициациясы анықталмады.

      Суретте көрсетілгендей. 7-суретте көрсетілгендей, BMV RNA3-тің олиго(A)/өзек промоторы аймағы кейбір басқа өсімдік РНҚ вирустарындағы субгеномдық мРНҚ басталу орындарының жанындағы аналогтық аймақтарға ұқсастықтарды қамтиды, соның ішінде сиырдың хлоротикалық ала вирусы (CCMV) және жоңышқа мозаикалық вирусы (AMV). BMV – субгеномдық промоторлар реттілігі эксперименталды түрде анықталған жалғыз (+) тізбегі РНҚ вирусы. ІНЖІР. 7 сонымен қатар BMV субгеномдық промотор аймағынан альфавирус субгеномдық РНҚ басталуының дәл жоғары ағынындағы консенсус тізбегіне дейінгі тізбектің маңызды гомологиясын көрсетеді (J.-H. Ou et al. (1982) Proc. Natl. Acad.). Sci. USA 79:5235-5239) субгеномдық РНҚ синтезін басқарудағы альфавирус консенсус тізбегінің функционалдығы тексерілмеген. Суретте көрсетілген реттілік ұқсастықтары. 7 BMV AvaI-SalI фрагментінде бір сәйкессіздіктермен үш рет қайталанатын AUCUAUGUU консенсус элементі BMV қабаттасады (7А-сурет). Жоғары қайталанатын тізбектердің жойылуы (4-сурет) субгеномдық промотор белсенділігінің төмендеуіне әкелді. Сонымен қатар, BMV RNAs1 және 2 ко-инфекцияда қамтамасыз етілгенде, RNA4 синтезі CCMV RNA3-тен дұрыс жүретіні көрсетілді және сол сияқты, BMV RNA3-тің CCMV RNAs 1 және 2-мен бірлескен инфекциялары дәл синтезделген RNA4 береді. BMV субгеномдық транскрипциясының бұрын жарияланған зерттеулері BMV жұқтырған арпа жасушаларынан алынған сығындыларды (L. Marsh et al. (1987) Positive Strand RNA Viruses, Alan R. Liss, Inc., New York) пайдалана отырып жүргізілген in vitro эксперименттеріне негізделген. W. Miller et al. (1985) Nature 313:68). Осы өнертабыстың жұмысы субгеномдық РНҚ синтезін зерттеу үшін in vivo эксперименттерін қолдану арқылы орындалды. Ағымдағы нәтижелер BMV RNA3 үшін cDNA-ның BglII-SalI аймағында in vivo кейбір субгеномдық промоторлық белсенділікке ие екенін көрсетеді, алайда BglII сайтының жоғары ағынында ақпарат реттілігі (бастауға қатысты AvaI-BglII аймағы -95-тен шамамен -21-ге дейін). сайт) РНҚ-тәуелді РНҚ полимераза арқылы субгеномдық РНҚ-ны тиімді синтездеу үшін қажет белсендіру доменін құрайды. Бұған қоса, осы өнертабыстың жұмысы субгеномдық промоторы бар ДНҚ фрагменті (мысалы, AvaI-SalI фрагменті) субгеномдық промотор белсенділігі сақталған РНҚ тізбегі ішінде жаңа орынға жылжытылуы мүмкін екенін көрсетті. Сонымен қатар, қазір бірнеше субгеномдық промоторлар көптеген субгеномдық РНҚ транскрипттеріне әкелетін бөлек сайттарда орналасса да, бір RNA3 туындысының ішінде жұмыс істейтіні көрсетілді. Әрі қарай, субгеномдық промотордың белсендіру доменін тасымалдайтын фрагмент субгеномдық промотордың жоғары ағынында қайталануы мүмкін екендігі анықталды, бұл күтпеген нәтиже субгеномдық транскрипцияны күшейтті.

      Осы өнертабыстың негізгі ерекшелігі суреттегідей нуклеотидтер тізбегі арқылы анықталған бром-мозаикалық вирустың субгеномдық промоторы болып табылады. 2, субгеномдық транскрипцияның бастапқы орнына қатысты нуклеотидтер -95 пен +16. Бұл нуклеотидтер тізбегі вирустық геномдағы жаңа сайттан субгеномдық РНҚ синтезін жабайы немесе одан да жоғары деңгейде бағыттау үшін жеткілікті болды. Бастапқы тораптың жоғары ағынында шамамен 20 негізден аспайтын тізбектер спецификалық инициацияны төмен деңгейде бағыттау үшін жеткілікті, сондықтан -21 және +16 арасындағы аймақ субгеномдық негізгі промотор деп аталады. Толық промоутер белсенділігі үшін кем дегенде 74-ке дейінгі, бірақ 95-тен көп емес негіздер қажет. -21 және -74 аралығындағы аймақтағы олиго(A) трактісі толық субгеномдық промотор белсенділігінің маңызды функционалды элементі болып табылады және тану ретінің элементі ретінде жұмыс істей алады немесе промоутердің басқа элементтері арасындағы қашықтықты немесе икемділікті қамтамасыз етуі мүмкін. AUCUAUGUU консенсус элементіне гомологиясы бар дәйектілік элементтерінің қызметі белгісіз, бірақ ДНҚ-тәуелді транскрипцияға ұқсастық бұл тізбектерді субгеномдық транскрипция деңгейін арттыру үшін транс-акциялық фактор(лар) арқылы тануға болатынын көрсетеді. Субгеномдық транскрипция деңгейінің одан әрі жоғарылауы AvaI-BglII фрагментінің реттілік ақпаратын бастапқы тораптан жоғары қарай көшіру арқылы алынды, суреттегідей. 2 және 5. Субгеномдық промотор RNA3 туындысының ішіндегі қалыпты сайттан басқа жерде болғанда, субгеномдық промотор құрылымдық геннің экспрессиясын бағыттау үшін пайдаланылуы мүмкін және субгеномдық транскрипцияның күшеюіне белсендіру доменінің қайталануы арқылы қол жеткізуге болады. субгеномдық промотордың бөлігі.

      Мұнда ұсынылған деректерден басқа көздерден субгеномдық промоторлардың орналасуын, оқшаулануын және пайдалануын осы салада қарапайым дағдылары бар адамдар артық экспериментсіз оңай жүзеге асыра алады. Суреттегі салыстырмалы реттілік деректері. 7 субгеномдық промоторлары бар белгілі РНҚ көздерінің кең ауқымында керемет гомологияны көрсетеді. Мұндай деректерден субгеномдық транскрипцияның басталу орындарындағы белгілі немесе оңай алынатын деректермен бірге BMV RNA3-ке баламалы субгеномдық промоторларды бөліп алуға және осы құжатта сипатталған және мысалға келтірілгендей пайдалануға болады. РНҚ-тәуелді РНҚ-полимеразалардың танылған гомологиясы мен әсер ету режимі гетерологиялық көздерден алынған субгеномдық промотор мен РНҚ-тәуелді РНҚ полимеразаның аралас комбинациясына мүмкіндік береді немесе осы құжатта BMV және CCMV үшін көрсетілген. Дегенмен, транскрипция жылдамдығы мен промотор спецификасындағы айырмашылықтар қолданылатын промотор мен полимеразаның нақты комбинациясына байланысты экспрессиядағы сандық айырмашылықтарға әкелуі мүмкін екені түсінікті болады.

      Осы өнертабыстың мақсаты бір нұсқада бром мозаикалық вирусының субгеномдық промоторы бола алатын РНҚ вирусының субгеномдық промоторының реттеуші бақылауымен құрылымдық геннің өсімдік тінінде күшейтілген экспрессиясының әдісін қамтамасыз ету болып табылады. Әдіс келесі қадамдардан тұрады: өсімдік тініне құрамында субгеномдық промотор және құрылымдық ген бар рекомбинантты ДНҚ молекуласын енгізу, осылайша аталған геннің экспрессиясы субгеномдық промотордың реттеуші бақылауында болады және барлық комбинация кәдімгі поли II болып табылады. промотор, не конститутивтік, не индукцияланатын, не дерепрессивті, жасушалық РНҚ полимераза II арқылы белсенді түрде субгеномдық промоторды қамтитын бастапқы, (-) тізбекті транскрипттің синтезі және құрылымдық геннің кодтау тізбегінің комплементі және РНҚ-ға тәуелді экспрессиясы РНҚ-полимераза белсенділігі (мысалы, модификацияланған өсімдік тінін бром-мозаикалық вируспен жұқтыру арқылы немесе polII промоторларының бақылауындағы BMV 1a және 2a гендерінің хромосомалық интеграцияланған көшірмелерін индукциялау арқылы), содан кейін екіншілік алу үшін субгеномдық транскрипция, (+) құрылымдық генді кодтайтын мРНҚ сезіледі, ол кейін оның ақуыз өнімін алу үшін аударылады. Бұл схеманың артықшылығы, РНҚ-тәуелді РНҚ-полимераза белсенділігі болмаған жағдайда құрылымдық геннің толық үнсіздігі бар, өйткені синтезделген (+) сезім РНҚ жоқ, демек, сол геннің ақуыз өнімін алу үшін трансляция мүмкін емес. Әдетте реттелетін полII промоторларының реттеуші бақылауындағы гендер және олармен байланысты тізбек элементтері тіпті индукциялық жағдайлар болмаған жағдайда да белгілі бір дәрежеде экспрессияны көрсетеді. Сондықтан субгеномдық промоторды пайдалану оны экспрессиялайтын жасуша үшін өлімге әкелетін геннің экспрессиясын болдырмау үшін пайдалы. Мұндай ген тек вирус жұқтырғаннан кейін ғана экспрессияланатындай қатаң бақыланса, оның экспрессиясы вирустың репликациясы мен таралуы басталғанға дейін жұқтырған жасушаны өлтіреді. Бұл процесс өсімдік тінінде вирустық инфекцияны бақылаудың тиімді құралы болып табылады, демек, егіннің зақымдануы мен экономикалық шығынның алдын алу әдісі. Егер өлімге әкелетін гендердің экспрессиясын бақылау іс жүзінде абсолютті болмаса, бұл схеманың артықшылығы жоғалады, сондықтан алдыңғы қатардағы поли II промоторларымен жүзеге асыру мүмкін емес.

      Субгеномдық промоторды қолданудың тағы бір салдары белсенді РНҚ-тәуелді РНҚ-полимераза болған кезде экспрессияның жылдам күшейтілуі болып табылады. Сондықтан промотор кенеттен экспрессия пайда болған кезде кез келген генді экспрессиялау үшін пайдалы. Мысалы, жоғары деңгейдегі гербицидке төзімділіктің жылдам, бірақ өтпелі экспрессиясын субгеномдық промотор бақылауындағы гербицидке төзімділік генін және индукцияланатын немесе басылмайтын поли II промоторының бақылауындағы РНҚ-тәуелді РНҚ полимеразаны қамтамасыз ету арқылы алуға болады. Соңғысын гербицидті құрамдас бөлікке жауап ретінде полимераза экспрессиясын қосу үшін таңдауға болады. Басқа спецификалық қарсылықтарды ұқсас жолмен реттеуге болады және әсіресе қарсылық улы жағымсыз немесе басқа да жағымсыз затты өндіруге әкелетін геннің экспрессиясының нәтижесі болған жағдайда пайдалы болады. Мұндай геннің жоғары деңгейлі, өтпелі экспрессиясына зиянсыз индукциялық агентті қолдану арқылы қол жеткізуге болады, осылайша қабылдаушы организмнің өмірлік циклінің дәл қажетті кезеңінде қажетті қарсылықты жасауға болады. Кейінірек, мысалы, егін жинау кезінде, ген экспрессияланбаған кезде, тұтынуға арналған өсімдік тінінде қажетсіз зат жоқ.

      Субгеномдық промотор-құрылымдық гендік комбинацияларды пайдалану тек өсімдіктермен шектелмейтінін осы өнерде қарапайым дағдылары бар адамдар түсінеді. Оң тізбекті РНҚ вирустары бактериялар мен жануарлар жасушалары үшін, сондай-ақ өсімдіктер үшін бар, ал субгеномдық промоторлардың гомологиясы өсімдіктер мен жануарлар вирустары үшін көрінеді. Сондықтан, субгеномдық промоторлардың бақылауындағы құрылымдық геннің экспрессиясы кез келген трансформацияланатын жасушада, соның ішінде, шектеусіз, өсімдік жасушаларында, жануарлар жасушаларында және бактерия жасушаларында орындалуы мүмкін.

      BMV субгеномдық промоторының транскрипциялық бақылауымен құрылымдық гені бар және экспрессиясы бар генетикалық түрлендірілген өсімдік тінін өндіру осы ашылудың арнайы ілімдерін техникада белгілі әртүрлі әдістермен және мақсаттармен біріктіреді. Көптеген жағдайларда процестің әр кезеңі үшін балама әдістер бар. Қажетті құралдарды таңдау өрнек кешенін енгізу және тұрақты ұстау үшін векторлық жүйені таңдау, модификацияланатын өсімдік, жануар немесе протисттік жасуша түрі және өсімдіктер жағдайында қалаған регенерация сияқты айнымалыларға байланысты. стратегия және қолданылатын арнайы құрылымдық ген, олардың барлығы осы салада қарапайым дағдылары бар адамдар қалаған нәтижеге қол жеткізу үшін таңдап, пайдалана алатын баламалы процесс қадамдарын ұсынады.

      Құрылымдық гендердің немесе басқа реттіліктердің гомологтары техникада жақсы түсінілген тиісті қатаңдық жағдайында олардың нуклеин қышқылдарының айқаспалы будандастыру қабілеті арқылы анықталуы мүмкін. Осы өтінімде пайдаланылған немесе ашылған реттіліктердің ішінде шамалы реттілік вариациялары болуы мүмкін екені түсінікті болады. Техникада белгілі, үлкенірек тізбегіндегі кейбір ДНҚ тізбегі функционалдылықты анықтауда басқаларына қарағанда маңыздырақ. Тәжірибелі шебер Д.Шортл және т.б. талқылағандарды қамтитын, бірақ олармен шектелмейтін белгілі мутагендік әдістермен артық тәжірибелерсіз дәйектілік бойынша рұқсат етілген вариацияларды сынай алады. (1981) Анн. Аян Генет. 15:265 M. Smith (1985) сол жерде. 19:423 Д.Ботштейн және Д.Шортл (1985) Ғылым 229:1193 байланыстырушы сканерлеу мутагенезі (S. McKnight and R. Kingsbury (1982) Science 217:316) немесе қанығу мутагенезі арқылы (R. Myers et al. (1986) Science 232:613). Бұл вариациялар осы жерде сипатталған талдау әдістерімен бірге стандартты әдістермен анықталуы мүмкін, бұл техникада тәжірибелі адамдарға поли II промоторларының, құрылымдық гендердің және субгеномдық промоторлардың функционалдық бірліктерін манипуляциялау және пайдалану мүмкіндігін беру үшін. Мұнда сипатталған әдістерді пайдалана отырып, білікті шебер артық экспериментсіз функцияны сақтау үшін субгеномдық промотор ішінде өзгертілген тізбектерді сынай алады. Генетикалық түрлендірілген өсімдік тінін алу үшін таңдаулы нұсқаның соңғы қадамдары құрамында Т-ДНҚ бар векторға экспрессия кешенін енгізу және модификацияланған Т-ДНҚ геномның бөлігі ретінде тұрақты түрде интеграцияланатын өсімдік тініне рекомбинантты ДНҚ тасымалдауды қамтиды. . Өсімдік жасушаларын түрлендірудің басқа әдістерін, соның ішінде протопласт трансформациясын, электропорацияны, микро-инъекцияны және агроинфекцияны қолдануға болады.

      Төмендегі мысалдар тек көрнекі мақсаттар үшін берілген және өнертабыстың ауқымын шектеуге арналмаған. Мысалдар молекулярлық биология өнерінде, өсімдік ұлпасындағы рекомбинантты ДНҚ-мен манипуляциялауда және трансформацияланған өсімдіктерді өсіру мен регенерациялауда жақсы белгілі және қол жетімді көптеген әдістерді пайдаланады. Жануарлар мен бактериялар жасушаларында рекомбинантты ДНҚ-мен ұқсас манипуляциялардың әдістері жақсы белгілі. Ферменттер коммерциялық көздерден алынады және жеткізушілердің ұсыныстарына немесе техникада белгілі басқа нұсқаларға сәйкес пайдаланылады. Реагенттер, буферлер және мәдени жағдайлар да өнерге белгілі. Стандартты молекулалық биологиялық процедураларды қамтитын сілтемелерге T. Maniatis және т.б. (1982) Молекулярлық клондау, Cold Spring Harbor зертханасы, Cold Spring Harbor, N.Y.R. Wu (ed.) (1979) Мет. Фермент. 68 R. Wu және т.б. (ред.) (1983) Әдістері Enzymol. 100 және 101 Л. Гроссман және К. Молдав (ред.) Әдістері Enzymol. (1980) 65 Дж. Миллер (ed.) (1972) Молекулярлық генетикадағы эксперименттер, Cold Spring Harbor зертханасы, Cold Spring Harbor, NY Old and Primrose (1981) Gene manipulation Principles, University of California Press, Беркли, Калифорния Р. Schlief and P. Wensink (1982) Practical Methods in Molecular Biology, Springer-Verlaz Berlin Glover (ed.) (1985) DNA Cloning, Vols. I және II, IRL Press, Oxford, UK B. Hames and S. Higgins (ed.) (1985) Nuclein Acid Hybridization, IRL Press, Oxford, UK P. Setlow and A. Hollaender (1979) Гендік инженерия: принциптері мен әдістері , Т. 1-4, Plenum Press, Нью-Йорк. Қолданылатын аббревиатуралар мен номенклатура осы салада стандартты болып саналады және осы құжатта келтірілгендер сияқты кәсіби журналдарда жиі пайдаланылады.

      Бұл мысал рекомбинантты ДНҚ молекулаларын және BMV субгеномдық промоторлар тізбегін сипаттау үшін пайдаланылатын клондау стратегияларын сипаттайды.

      1.1 Транскрипциялық векторлық плазмидалардағы бром мозаикалық вирусының жабайы типті кДНҚ клондары

      pB1TP3, pB2TP5 және pB3TP8 плазмидаларында сәйкесінше BMV РНҚ 1, 2 және 3 кДНҚ көшірмелері бар, олардан толық BMV геномының дұрыс басталған, жабылған және инфекциялық транскрипттерін T7 РНҚ полимеразасымен жасауға болады (М. Джанда және т.б. (1987) Вирол. 158:259). RNA3 туындыларын жасауда пайдаланылған басқа плазмидалар pB3TP7 (M. Janda et al. (1987) және pB3PM1 (P. Ahlquist and M. Janda (1984) Mol. Cell. Biol. 4:2876-2882). Бұл плазмидалардың құрамында бар. pB3TP8 сияқты бірдей BMV cDNA аймағы, бірақ бір аралық G қалдығы бар T7 промоторымен байланысқан және тиісінше тікелей E. coli промоторымен байланысқан. pB3M1-ден басқа жоғарыда аталған плазмидалардың барлығы pUC119 туындылары, сондықтан ssDNA репликациясын қамтиды. M13K07 (Дж. Виейра ұсынған) сияқты қолайлы көмекші фагпен суперинфекциядан кейін ssDNA формаларын қалпына келтіруге мүмкіндік беретін M13 бактериофагының шығу тегі.

      1.2 Мутантты BMV конструкциялары бар плазмидалық конструкциялар

      Стандартты әдістер шамалы өзгертулермен қолданылды (T. Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). Әртүрлі рестрикциялық эндонуклеазалармен түзілген фрагменттердің комплементарлы емес ұштарын біріктіру үшін 3' шығыңқы ұштары T4 ДНҚ-полимеразамен кесілген, ал 3' ойық ұштары E. coli ДНҚ полимераза I немесе T4 ДНҚ полимеразасының үлкен фрагменті арқылы тұйықтылыққа дейін ұзартылды. .

      pB3IC4: E. coli RZ1032 (dut, ung) (T. Kunkel (1985) Proc. Nat. Acad. Sci. USA 82:488) pB3TP8 түрлендірілді және M13K07 суперинфекциясынан кейін dUTP бар ssDNA оқшауланды. Бұл ДНҚ pB3TP8 интерцистрондық олиго(A) трактісінің 18 қалдығының 17-сін жою үшін олигонуклеотидтерге бағытталған мутагенездің үлгісі ретінде пайдаланылды (Кункел, 1985), ал өнімнің клондары дидеоксинуклеотидтерді секвенирлеу арқылы скринингтен өтті (М. Бигген және т.б.). (1983) Proc. Nt. Acad. Sci. USA 80:3963). Қолданылған мутагендік олигонуклеотид d(GACATAGATCTAATAATAAC) болды. BglII учаскесін негізгі промотордың 5' шекарасында сақтау үшін олигодан (A) бір А қалдығы сақталды. pB3IC4 - субгеномдық промотор аймағында олиго(А) трактісі жоқ плазмид.

      pB3SG5, 5R, 9, 10, 11, 13, 14, 15, 21, 22: pB3TP7 AvaI- SacI фрагментінің көшірмелері pB3TP7: XB3SSB: XB3SSB: RNA3 cDNA аймағының көрсетілген учаскелеріне қайталанулар ретінде енгізілді. ClaI pB3SG9: ClaI, XbaI pB3SG10: XbaI,StuI pB3SG13 ClaI, XbaI, StuI pB3SG14: NsiI, XbaI, StuI. Шектеу талдауы қоршаған cDNA сияқты бірдей бағыттағы кірістірулерді таңдау үшін пайдаланылды. Субгеномдық промотор фрагментін бірнеше рет енгізу арқылы сол туындыларды құру үшін клондаудың бірнеше айналымдары қажет болды. Бірнеше промоторлық конструкциялар жағдайында кіші AvaI-SalI фрагменті емес, AvaI-SacI фрагментін пайдалану гельдік электрофорез арқылы өлшемі бойынша дифференциалданатын нәтижесінде алынған субгеномдық РНҚ түрлерін ажыратуға мүмкіндік берді.

      pB3SG5R құрамында AvaI-SaCI фрагменті pB3TP7 XbaI орнында кері бағытта орналасқан.

      pB3SG11 құрамында AvaI-SalI фрагменті pB3TP7 XbaI торабындағы көшірме ретінде бар. Сол сияқты, pB3SG15, pB3SG21 және p322 тиісінше BglII-SalI, BsXI-SalI және DdeI-SalI фрагменттерін қамтиды.

      pB3SG6, 6R: pB3BB1 - pB3TP7 туындысы, онда 1168-базадан SacI төменгі ағынына дейін жою енгізілген (R. A. French және P. Ahlquist), (1987) Дж. Вирол. 61:1457). pB3TP8 AvaI-SacI фрагменті pB3BB1 XbaI сайтына pB3SG6 жасау үшін қоршаған cDNA сияқты бағытта және pB3SG6R жасау үшін кері бағытта енгізілді.

      pB3IC2, 3, 5, 6: Жеке конструкцияларда BamHI линкері (CGCGGATCCGCG, New England Biolabs) pB3M1 AvaI және BglII алаңдарына Кленов ДНҚ полимеразасымен ойық ұштарын толтырғаннан кейін енгізілді. Осы плазмидалардың әрқайсысының шағын PstI-BamHI фрагменті pB3BC1 (French және Ahlquist, 1987) үлкен PstI-BamHI фрагментімен байланыстырылып, тиісінше pB3IC2 және pB3IC3 кДНҚ қайталануы бар аралық плазмидалар алынды. Әр плазмидтің шағын PstI-ClaI фрагменті pB3IC2 және pB3IC3 алу үшін pB3TP8 шағын PstI-ClaI фрагментімен (in vitro транскрипциясы үшін E-coli промоторына бактериофаг T7 промоторын ауыстыру үшін) ауыстырылды. Екі қосымша конструкцияда pB3HS1 үлкен EcoRI-HincII фрагменті (француз және Ahlquist, 1987) pB3TP8 немесе pB3IC4 шағын AvaI-EcoRI фрагментімен байланыстырылды. Алынған плазмидалардың үлкен BglII-EcoRI фрагменттері, тиісінше, pB3IC5 және pB3IC6 алу үшін pB3BC1 шағын BamHI-EcoRI фрагментімен жеке-жеке байланыстырылды.

      In vitro транскрипциясы, протопласт егу және РНҚ талдауы

      Бұл мысал BMV жабайы түрінің немесе өзгертілген субгеномдық промоторлар реттілігінің функционалдығын тексеру үшін қолданылатын әдістерді сипаттайды.

      Арпа протопластары сипатталғандай бөлініп алынды (L. Loesch-Fries және T. Hall (1980) J. Gen. Virol. 47:323). m7GpppG немесе GpppG қатысуымен in vitro транскрипциясы, протопласты егу және инкубациялау, вирустық РНҚ экстракциясы және алынған авторрадиографтарды талдау және денситометрия сипатталғандай жүргізілді (French және Ahlquist, 1987). Әрбір плазмида құрылысы кем дегенде үш тәуелсіз экспериментте сыналған. (+) РНҚ тізбегіне арналған зондтар pB3HE1 қосалқы клонынан алынған 32P таңбаланған SP6 транскрипті болды, оның құрамында pB3TP8 3' терминалдық RNA3 cDNA тізбегінің 200 негізгі HindIII-EcoRI фрагменті немесе белгілі эксперименттерде (MS 6-суреті) a RNA3-тің BglII-SacII аймағына комплементарлы in vitro транскриптіне ұқсас. Теріс тізбекті РНҚ талдауы үшін денатурациялық гель электрофорезі формальдегид гендерінде жүргізілді (Maniatis және т.б., 1982). Теріс тізбекті РНҚ-ға арналған зондтар BMV RNA3-тің AvaI-SacI аймағын қамтитын субклондардан алынған in vitro транскрипттері болды.

      РНҚ1 және RNA2 cDNA клондарының (pB1TP3 және pB2TP5) транскрипттерімен және сәйкес RNA3 cDNA клонының транскрипттерімен 106 протопласты егілгеннен кейін праймерді ұзарту эксперименттері жүргізілді. Үздіксіз жарықта 24 сағат инкубациядан кейін жалпы нуклеин қышқылдары бөлініп, 15 мкл ddH2O ерітілді. Осы нуклеин қышқылының 1,5 мкл 1 нг 5'-32P таңбаланған d(GCGAGTCATCTTACC) (BMV RNA4 28-42 негіздеріне қосымша) жалпы көлемі 4 мкл болатын кері транскриптазаның 1,5 бірлігімен (Life Sciences, Inc) араластырылды. .) әрқайсысы 25 мкМ дезоксинуклеотидтер және соңғы концентрациясы 25 мМ Tris-Cl pH 8,3, 5 мМ MgCl2, 25 мМ KCl және 5 мМ DTT. 30 мин инкубациядан кейін. 37 C., өнімдер 95 C. 3 мин денатуратталған. тең көлемде 90% формамид, 20 мМ ЭДТА, 0,1% ксилол цианол, 0,1% бромфенол көк және 3 мкл аликвоттар 12% полиакриламидте, 8,3М мочевина гелінде электрофорезденді. Әрбір реакцияның құрамында 50 мкм бір дезоксинуклеотид болғанын қоспағанда, таңбалау жолақтары ұқсас дайындалды, ал шаблон M13K07 көмекші фагымен pB3SG6 трансформацияланған E. coli суперинфекциясынан кейін оқшауланған фаг бөлшектерінен дайындалған ssDNA болды. Кезеңді салыстыру Висконсин университетінің генетикалық компьютерлік тобының бағдарламалық құралының көмегімен жасалды.

      pB3-SGP құрылысы және ген экспрессиясы

      Бұл мысал BMV субгеномдық промоторының транскрипциялық бақылауымен хлорамфеникол ацетилтрансфераза (CAT) белсенділігінің экспрессиясын басқаратын cDNA RNA3 туындысының құрылысын сипаттайды, мұнда субгеномдық промотор-CAT гендік кешенінің экспрессиясы жаңа сайттан алынған. RNA3 молекуласы.

      Субгеномдық промотор-CAT гендік кешені pB3CA42 AvaI-PstI фрагменті ретінде клондалған (R. French et al. (1986) Science 231:1294). Бір тізбекті ұштарды Кленоу ДНҚ полимеразасымен толтырғаннан кейін, бұл фрагмент ұқсас өңдеуден кейін pB3TP7 XbaI сайтына клондалады, нәтижесінде алынған плазмиданың шағылысқан ұштарын жасайды, онда субгеномдық промотор-CAT гендік кешенінің бағыты келесідегідей болады. қоршаған кДНҚ pB3-SGP деп аталады.

      РНҚ транскрипттері 2-мысалда сипатталғандай арпа протопластарына енгізіледі. CAT генінің белсенділігі French et al., 1986 сипатталғандай өлшенеді.

      pBMVSGP құрылысы және BMV басқаратын екі сатылы ген экспрессиясы

      Бұл мысал BMV субгеномдық промоторы мен бактериялық левомицетин ацетилтрансфераза (CAT) генін қамтитын рекомбинантты ДНҚ молекуласының құрылысын сипаттайды, осылайша CAT генінің экспрессиясы субгеномдық промотордың реттеуші бақылауында болады. Бұл молекула BMV субгеномдық промоторға тәуелді CAT генін техникада белгілі кез келген тәсілмен өсімдік тініне азайту үшін пайдаланылуы мүмкін. РНҚ-тәуелді РНҚ полимераза белсенділігін қамтамасыз ету үшін BMV геномдық РНҚ-ларымен өңдеу арқылы генетикалық түрлендірілген өсімдік тінін өңдеу, содан кейін субгеномдық промотордың бақылауымен CAT генінің экспрессиясын қосады.

      pB3CA42 (R. French және т.б. (1986) Science 231:1294) AvaI-PstI фрагменті субгеномдық промотор-CAT генінің комбинациясын қамтамасыз етеді. Кленоу ДНҚ полимеразасымен барлық бір тізбекті саңылауларды жөндегеннен кейін, бұл фрагмент pGA355+26 BamHI орнына енгізіледі (G. An et al. (1986) Mol. Gen. Genet. 203:245). Шектеу эндонуклеаза дайджесттері PstI-ұшы nos промоторына іргелес болатын өнімді таңдау үшін орындалады, бұл рекомбинант pBMVSGP болып табылатын polII промоторы. Осылайша, nos промоторы басқаратын бастапқы транскрипт субгеномдық промоторға және CAT кодтау аймағына қатысты (-) тізбек болады. Бастапқы транскрипттің нос-туынды бөлігінде аударманы бастау орны жоқ.

      pBMVSGP темекі протопластарына электропорация әдісі арқылы енгізіледі (M. Fromm et al. (1985) Proc. Natl. Acad. Sci. 82:5824). Бастапқы (-) тізбекті транскрипттер II жасушалық РНҚ полимеразасымен конститутивті түрде синтезделеді.

      CAT субгеномдық промоторға тәуелді экспрессиясы Л. Лоеш-Фрис және т.б. сипаттағандай, генетикалық түрлендірілген темекі протопластарына РНҚ-тәуелді РНҚ полимераза белсенділігінің көзі ретінде BMV РНҚ-ларын енгізу арқылы орындалады. (1985) Вирусология 143:626. CAT ферментативті белсенділігі сипатталғандай өлшенеді (French et al. (1986)).


      Спутниктік субгеномдық бөлшектер аденомен байланысты вирустың өмірлік циклінің негізгі реттеушілері болып табылады.

      Тарихи түрде AAV ақаулы кедергі жасайтын бөлшектер (DI) табиғи репликация мен инкапсидация қателерінен туындайтын қалыптан тыс вириондар ретінде белгілі болды. Бір вириондық геномды талдау арқылы біз DI бөлшектерінің негізгі санатында «snapback» конфигурациясында (SBG) қос тізбекті ДНҚ геномы бар екенін анықтадық. 5'-SBGs P5 промоторларын және ішінара реп ген тізбегін қамтиды. 3'-SBGs капсид аймағын қамтиды. 5'-SBG молекулалық конфигурациясы олардың димер конфигурациясында қос тізбекті РНҚ транскрипциясына мүмкіндік берді, бұл өз кезегінде AAV репрессиясын реттейді және AAV қаптамасын жақсартуы мүмкін. Керісінше, 3'-SBGs оның димер конфигурациясында қақпақ ақуызының деңгейін жоғарылатты. 5'-SBG және 3'-SBGs генерациясы мен жинақталуы вирустық геннің экспрессия деңгейін теңестіру үшін үйлестірілген сияқты. Сондықтан 5'-SBGs және 3'-SBGs функциялары AAV ұрпақтарының шығымдылығын арттыруға көмектесуі мүмкін. Біз AAV вирусының популяциясы өзін колония ретінде ұстанып, оның субгеномдық бөлшектерін вирустық геномның өлшем шегін еңсеру үшін пайдаланады және қосымша маңызды функцияларды кодтайды деп болжаймыз.