Ақпарат

CDNA кітапханасы мен РНҚ тізбектелуінің айырмашылығы туралы (Биохимия техникасы)

CDNA кітапханасы мен РНҚ тізбектелуінің айырмашылығы туралы (Биохимия техникасы)


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Неліктен кДНҚ кітапханасын құру кері транскрипция (яғни дәйектілікті ДНҚ-ға айналдыру) қадамын қажет етеді деп ойладым, неге экстракцияланған РНҚ-ны секвенирлеу және U-ды Т негізіне түрлендіру үшін тікелей пайдаланбасқа? Тағы бір қадам жасаудың қажеті не? супер шатастыратын


cDNA кітапханасының құрылысы мРНҚ-ның ДНҚ «көшірмелерін» жасауды қамтиды, себебі олардың әрқайсысында әртүрлі кДНҚ бар және әрқайсысында E. coli-де таралатын рекомбинантты плазмида молекулаларының үлкен жиынтығын синтездеу мақсаты тұр.

КДНҚ кітапханасы құрылысының гүлденген кезеңі ПТР өнертабыстарына дейін болды.

Сіз салыстырып отырған екі тәсілдің негізгі айырмашылығы мынада: біреуі (cDNA кітапханасы) экспрессиялық геномның физикалық көрінісін жасауды қамтиды, ал екіншісі ақпараттық өкілдік болып табылады.


Геномдық кітапханалар

Геномдық кітапханалардың болашағы

Геномдық кітапхана құрылысы молекулалық биологиядағы маңызды әдіс болып қала береді. Бұл ресурстар геннің қызметін талдау үшін және әр түрлі көздерден байланысты гендерді анықтау үшін өте маңызды. Геномдық кітапханалар қазіргі уақытта микробқа қарсы препараттар сияқты жаңа табиғи өнімдерді іздеуде қолданылады. Олар сонымен қатар жаңа биохимиялық жолдарды ашу және оңтайландыру үшін қолданылады, мысалы, биоотын мен басқа да күрделі химиялық заттарды өндіруге қажет. Сонымен қатар, геномдық кітапханалар NGS-тен шығарылатын жүйелілік ақпаратының үлкен көлемін жинаудың маңызды құралы болып қала береді.

Синтетикалық биологияның пайда болуымен миллиондаған негізгі жұптары бар фрагменттерді басқаруға болады, бұл бүкіл жолдар мен геномдарды инженериялауға мүмкіндік береді. Бұл технологияның қазіргі таңдағы ерекшелігі - тұтас бактерия геномын құрастыру (Микоплазма зертханасы) зертханада синтезделген оның ата -аналық гендерінің жиынтығынан. Соған қарамастан, қолда бар құралдар әлі бастапқы сатысында, ал технология қымбат және көп уақытты қажет етеді. Геномдық кітапханалардың болашағы кез келген қалаған генетикалық элементтері бар жасанды хромосомаларды оңай құрылатын «құрылыс блоктарын» қолдану әдістерінде болуы мүмкін. Мұндай әдістер толығымен синтетикалық, алдын ала бағдарламаланған геномдарға әкелуі мүмкін және қазірдің өзінде дамуда.


RNA-seq талдауы кобиядағы гипер- және гипо тұздылыққа әр түрлі адаптивті реакцияны көрсетеді, Rachycentron канадасы

Тұздық - бұл метаболикалық және физиологиялық белсенділікке, теңіз балықтарының тұқымына, дамуы мен өсуіне әсер ететін маңызды абиотикалық стресс. Зерттеулер көрсеткендей, кобия (Rachycentron канадасы), эуригалинді теңіз телеосты балығы, гипер/гипоионо- және осморегуляцияның жылдам және тиімді қабілетіне ие. Алайда, бұл түр бойынша геномдық зерттеулер жоқ және тұздылықтың реттелуіне жауап беретін гендерді анықтау үшін транскриптомдық деңгейде зерттелмеген, бұл тұздылықтың ауытқуына бейімделудің негізгі механизмін түсінуге әсер етеді. Кобияның әртүрлі тұздылық деңгейлеріне молекулалық реакциясын сипаттау үшін біз тұздылықтың өзгеруіне жауап беретін гендер мен биологиялық процестерді анықтау үшін РНҚ-секв талдауын қолдандық. Осы зерттеуде 395,080,114 таза оқылым құрылды, содан кейін N50 өлшемі 2758 bp болатын 65 318 унигенге жиналды. Гипо тұздылыққа бейімделген 8805 ген және гипер тұздылыққа бейімделген 8666 генді қосқанда 20671 айтарлықтай дифференциалданған гендер (DEGs) болды. Бұл DEGs стероидты биосинтезде, қанықпаған май қышқылдарының метаболизмінде, глутатион алмасуында, энергия алмасуында, осморегуляцияда және иммундық жауапта жоғары дәрежеде ұсынылды. Кобияда анықталған кандидат гендер теңіз балықтарының тұздылыққа бейімделуінің молекулалық механизмін зерттеу үшін құнды ақпарат береді. Сонымен қатар, транскриптомдық тізбектеу деректері жаңа гендерді сәйкестендіру үшін маңызды ресурс ретінде ғана емес, сонымен қатар кобия биологиясына қатысты қосымша зерттеулер үшін де қызмет етеді.

Бұл жазылу мазмұнының алдын ала қаралуы, сіздің мекеме арқылы кіру.


Trio RNA-Seq™ кітапхананы дайындау жинағы

Бірегей RNA-Seq кітапханалық дайындығы сирек транскрипцияны анықтау және патогенді бейтарап ашу үшін төмен кіріс және сапасыз үлгілерден тұтас RNA-Seq транскриптомы үшін жеңілдетілген шешімді қамтамасыз ету үшін үш меншікті технологияны біріктіреді.

Өнім жаңалықтары: COVID-19 зерттеуі

Сезімтал вирусты анықтауға арналған NGS шешімдері.

COVID-19 айналасындағы тез дамып келе жатқан жағдайға байланысты, Tecan жаңа коронавирустың эволюциясы туралы түсінік алуға көмектесетін құралдарды ұсыну үшін мұқият жұмыс жасайды.

Біздің Trio RNA-Seq NGS кітапханасына дайындық шешімі зерттеушілерге шектеулі, деградацияланған үлгілердегі вирустарды сәтті зерттеуге мүмкіндік берді. Жақында рецензияланған басылымдар Trio RNA-Seq пациенттердің үлгілерінен жаңа коронавирусты анықтауда, сондай-ақ SARS-CoV-2 эволюциялық тарихы мен вируленттілігі туралы түсінік беруде пайдалылығын көрсетті.

Trio және басқа NGS шешімдеріміздің COVID-19 зерттеуіне қалай көмектесетінін білу үшін осы жерді басыңыз.

Күрделі үлгілерден сирек транскрипттерді сезімтал анықтау

РНҚ кітапханасын күрделі немесе аралас үлгілерден дайындау, олардың көптігі немесе сирек кездесетін транскрипциясын анықтау өте маңызды, көптеген зерттеушілер үшін күрделі мәселе болып табылады. Стандартты RNA-Seq әдістері аралас үлгілердегі сирек транскрипттерді секвенирлеуге жарамды үлгілерді генерациялау үшін адекватты емес. Стандартты RNA-Seq жинақтары SARS-CoV-2 сияқты вирустық қоздырғыштарды анықтай алмайды немесе нейробиологиялық үлгілер сияқты күрделі тіндерден белгілі бір жасуша түрлеріндегі бірегей экспрессивті гендерді анықтай алмайды.

Trio бірегей күшейту технологиясы (бір праймер изотермиялық күшейту, SPIA) вирустар сияқты патогендердің аз мөлшерін және аз мөлшерін анықтауға мүмкіндік береді. Бұл бейтарап күшейту әдісі стандартты RNA-Seq жұмыс процестерімен салыстырғанда кітапхананы дайындау үшін көбірек молекулалар жасайды және үлгілерден биологиялық ақпаратты сақтайды. SPIA сіздің қызығушылық транскриптіңізді жақсырақ күшейтуге мүмкіндік беретін қиын үлгі көздерінен ингибиторларға шыдай алады.

Trio RNA-Seq SPIA-ді DimerFree адаптациясы мен AnyDeplete-дің мақсатты транскриптінің сарқылуын біріктіретін NGS кітапханасына дайындықтың ең жақсы және жоғары деңгейлі жүйесін ұсынады, ол сирек кездесетін төмен сападағы және сапасыз үлгілерден алынған RNA-Seq транскриптомының оңтайлы шешімін ұсынады. транскриптті анықтау және патогенді бейтарап ашу.

Trio RNA-Seq кітапханасын дайындау жинағының артықшылықтары:

  • Сұйық биопсияға, FFPE, мұрын жағындысына және төмен кірісі бар басқа да қиын үлгілерге арналған РНҚ секвенирлеу шешімі.
  • Кітапхана құрылысынан кейін рРНҚ -ның сарқылуын теңшеңіз, транскриптомдық мәліметтерден ақпараттық тізбекті барынша көбейтіңіз.
  • Ферментативті фрагментация және DimerFree кітапханасының құрылысы кітапхананы тиімді және сенімді дайындауға мүмкіндік береді.
  • UDI көмегімен индекстің өтуін анықтаңыз.
  • Кіріс ауқымы 500 пг - 50 нг жалпы РНҚ.
  • COVID-19 мен жұқпалы ауру қоздырғыштарын анықтау мен сипаттауға өте ыңғайлы.

Trio төмен кіріс RNA-Seq адамның rRNA-сына бағытталған AnyDeplete зондтарымен (No 0506 бөлім) және тінтуірдің rRNA-сына бағытталған AnyDeplete зондтарымен (No 0507 бөлім) ұсынылады. AnyDeplete зондтар жиынтығы кез келген ағзадан кез келген транскриптке теңшелуі мүмкін. Арнайы тексерулер жиынтығын алу үшін, сіздің есептік жазбаңыздың басшысына хабарласыңыз немесе біздің веб -сайтта баға ұсынысын сұраңыз.


Әдебиеттер

Дженнер, Р.Г. & Янг, Р.А. Транскрипциялық профилдеудің патогендерге қарсы қабылдаушы жауаптары туралы түсінік. Микробиол. 3, 281–294 (2005).

Хоссейн, Х., Чаталбачев, С. & Чакраборти, Т. Патоген-хост өзара әрекеттестігінде хост генінің экспрессиясы. Ақша Опин. Иммунол. 18, 422–429 (2006).

Раппуоли, Р. Жасушалық микробиологияның шектерін итеру: микроорганизмдер - хост жасушаларының интимдік байланыстарын зерттеу. Проц. Natl Acad. Ғылым. АҚШ 97, 13467–13469 (2000).

Фодор, S. P. және т.б. Биологиялық чиптермен мультиплексирленген биохимиялық талдаулар. Табиғат 364, 555–556 (1993).

Schena, M., Shalon, D., Davis, R. W. & amp Brown, P. O. ДНҚ -ның комплементарлы микроарреймі бар гендердің экспрессия үлгілерін сандық бақылау. Ғылым 270, 467–470 (1995).

Selinger, D.W., Saxena, R.M., Cheung, K.J., Church, G.M. & Rosenow, C. Жаһандық РНҚ талдау Ішек таяқшасы транскрипт деградациясының позициялық заңдылықтарын ашады. Genome Res. 13, 216–223 (2003).

Ямада, К. және т.б. Транскрипциялық белсенділікті эмпирикалық талдау Арабидопсис геном Ғылым 302, 842–846 (2003).

Бертоне, П. және т.б. Геномды плиткалау массивтері бар адамның транскрипцияланған тізбектерін жаһандық сәйкестендіру. Ғылым 306, 2242–2246 (2004).

Меррелл, Д.С. және т.б. Холера бактериясының қоздырғышты эпидемиялық таралуы. Табиғат 417, 642–645 (2002).

Revel, A. T., Talaat, A. M. & Norgard, M. V. Дифференциалды ген экспрессиясының ДНҚ микроаррей талдауы Боррелия бургдорфери, Лайм ауруы спирохеті. Проц. Natl Acad. Ғылым. АҚШ 99, 1562–1567 (2002).

Белланд, Р.Ж. және т.б. Даму циклінің геномдық транскрипциялық профилін жасау Хламидиоз трахоматисі. Проц. Natl Acad. Ғылым. АҚШ 100, 8478–8483 (2003).

Маурер, А.П., Мехлиц, А., Молленкопф, Х.Ж. & Мейер, Т.Ф. Геннің экспрессия профильдері Chlamydophila pneumoniae даму циклі және темірдің азаюына байланысты табандылық кезінде. PLoS патоги. 3, e83 (2007).

Эрикссон, С., Луччини, С., Томпсон, А., Рен, М. & Хинтон, Дж. Жасушаішілік гендік экспрессия профилі арқылы макрофаг инфекциясының биологиясын ашу. Сальмонелла ішек. Мол. Микробиол. 47, 103–118 (2003).

Гауфорт, I. және т.б. Эпителий жасушаларының инфекциясы кезінде Сальмонелла ішек serovar Typhimurium 3 типті үш секреция жүйесінің бір мезгілде экспрессиясына әкелетін уақытқа тәуелді транскрипциялық бейімделуден өтеді. Ұяшық Микробиол. 10, 958–984 (2008).

Толедо-Арана, А. және т.б. The Листерия сапрофитизмнен вируленттілікке дейінгі транскрипциялық ландшафт. Табиғат 459, 950–956 (2009).

Перес, Н. және т.б. Адам патогенді А тобындағы кіші реттеуші РНҚ геномдық талдау Стрептококк. PLoS ONE 4, e7668 (2009).

Кумар, Р. және т.б. Жаңа кодталмаған шағын РНҚ-ны анықтау Streptococcus pneumoniae TIGR4 жоғары ажыратымдылықтағы геномды төсеу массивтерін пайдаланады. BMC Genomics 11, 350 (2010).

Чжэн, X. және т.б. Жоғары патогенділікпен байланысты гендер мен геномдық аралдарды анықтау Стрептококк тұтас геномды плиткамен қаптауды қолдану. PLoS ONE 6, e17987 (2011).

Der, S. D., Zhou, A., Williams, B. R. & Silverman, R. H. Олигонуклеотидті массивтерді пайдалана отырып, интерферон α, β немесе γ арқылы дифференциалды түрде реттелетін гендерді анықтау. Проц. Natl Acad. Ғылым. АҚШ 95, 15623–15628 (1998).

Zhu, H., Cong, J. P., Mamtora, G., Gingeras, T. & amp Shenk, T. Адам цитомегаловирусымен өзгертілген жасушалық геннің экспрессиясы: олигонуклеотидтік массивтермен жаһандық мониторинг. Проц. Natl Acad. Ғылым. АҚШ 95, 14470–14475 (1998).

Хеджес, Дж.Ф., Любик, К.Ж. & Жутила, М.А. γδ Т-жасушалары патогенмен байланысты молекулалық үлгілерге тікелей жауап береді. J. Иммунол. 174, 6045–6053 (2005).

Кернс, Х.М., Ютила, М.А. & Хеджес, Дж.Ф.Т -жасушаларының Nod2 агонисті мурамил дипептидке нақты реакциясы. Ұяшық Иммунол. 257, 38–43 (2009).

Тросс, Д., Петренко, Л., Класчик, С., Жу, Q. & amp Клинман, D. M. TLR9 мен TLR3 индукцияланған гендік экспрессия мен синергетикалық өзара әрекеттесудің жаһандық өзгерістері. Мол. Иммунол. 46, 2557–2564 (2009).

Motley, S. T. және т.б. Қоздырғыштар мен патогендердің өзара әрекеттесуін бір мезгілде талдау in vivo Инфекция жергілікті жедел фазалық реакция ақуыздарының жергілікті индукциясын, бактериялық стресстің жаңа реакциясын және металл ионының шектеулі ортасы бар екенін көрсетеді. Ұяшық Микробиол. 6, 849–865 (2004).

Велкулеску, В.Е., Чжан, Л., Фогельштейн, B. & amp Кинзлер, К.В. Гендік экспрессияға сериялық талдау. Ғылым 270, 484–487 (1995).

Шираки, Т. және т.б. Транскрипциялық бастапқы нүктені жоғары өткізу қабілеттілігін талдау және промоутерлердің қолданылуын анықтау үшін гендік экспрессиялық талдау. Проц. Natl Acad. Ғылым. АҚШ 100, 15776–15781 (2003).

Matsumura, H., Kruger, D. H., Kahl, G. & amp Terauchi, R. SuperSAGE: геномдық сандық транскрипцияны профильдеуге арналған заманауи платформа. Ақша Фарма. Биотехнология. 9, 368–374 (2008).

Кронстад, Дж. В. Эукариоттық патогендердегі ген экспрессиясының сериялық талдауы. Жұқтыру. Бұзушылық. Дәрілік заттардың мақсаттары 6, 281–297 (2006).

Каналес, R. D. және т.б. Гендердің сандық экспрессиялық платформаларымен ДНҚ микромассив нәтижелерін бағалау. Табиғат биотехнологиясы. 24, 1115–1122 (2006).

Ванг, З., Герштейн, М. және Снайдер, M. RNA-Seq: транскриптомиканың революциялық құралы. Табиғат рев. Генет. 10, 57–63 (2009).

Сұлтан, М. және т.б. Адам транскриптомын терең секвенирлеу арқылы ген белсенділігінің жаһандық көрінісі және баламалы сплайсинг. Ғылым 321, 956–960 (2008).

Мариони, Дж.С., Мейсон, Ч.Э., Мане, С.М., Стивенс, М. & Гилад, Ю. РНҚ-сек: техникалық репродуктивтілікті бағалау және гендік экспрессивті массивтермен салыстыру. Genome Res. 18, 1509–1517 (2008).

Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L. & Wold, B. RNA-Seq бойынша сүтқоректілердің транскриптомдарын картаға түсіру және сандық анықтау. Табиғат әдістері 5, 621–628 (2008).

Морин, R. және т.б. Кездейсоқ праймерленген cDNA және жаппай параллельді қысқа оқу секвенциясы арқылы HeLa S3 транскриптомының профилін жасау. Биотехника 45, 81–94 (2008).

Перкинс, Т.Т. және т.б. Іш сүзегінің таяқшасының транскриптомына арнайы РНҚ-сек талдау Сальмонеллалар Тифи PLoS Genet. 5, e1000569 (2009).

Йодер-Химес, ДР және т.б. Картаға түсіру Burkholderia cenocepacia жоғары өткізу қабілеттілігі бойынша тауашалық жауап. Проц. Natl Acad. Ғылым. АҚШ 106, 3976–3981 (2009).

Оливер, H. F. және т.б. РНҚ -ның терең тізбектелуі L. monocytogenes бір-біріне сәйкес келетін және кең стационарлық фазаны және сигма В-ға тәуелді транскриптомдарды, соның ішінде бірнеше жоғары транскрипцияланған кодталмаған РНҚ-ны көрсетеді. BMC Genomics 10, 641 (2009).

Шарма, C. M. және т.б. Адамның негізгі қоздырғышының негізгі транскриптомы Хеликобактериялар. Табиғат 464, 250–255 (2010). Гендік экспрессияны талдау және кодталатын және кодталмайтын ақпаратқа және оперондық құрылымға қатысты бактериялық транскриптомға аннотация беру үшін жалпы РНҚ-ның тізбекке тән РНҚ-сегментін қолданудың жақсы мысалы.

Toung, J. M., Morley, M., Li, M. & amp Cheung, адамның B-жасушаларының В.Г. РНҚ-реттілігін талдау. Genome Res. 21, 991–998 (2011). Гендердің ашылуы мен экспрессияның сандық көрсеткіштері сияқты әр түрлі биологиялық қосымшаларды қамту талаптарын анықтайтын, адамның В жасушаларына жүргізілген терең транскриптомдық зерттеу.

Вильгельм, Б.Т. & Ландри, J. R. RNA-Seq-жаппай параллель РНҚ-реттілігі арқылы өрнектің сандық өлшемі. Әдістері 48, 249–257 (2009).

Xiong, J. et al. Протозойлық модельге транскриптомдық талдау, Тетрагименалық термофила, терең РНҚ тізбегін қолдану. PLoS ONE 7, e30630 (2012).

Голландия, M.J. Ашытқының транскриптінің көптігі алты дәрежеден асады. J. Биол. Химия 277, 14363–14366 (2002).

Trapnell, C. et al. Транскрипт құрастыру және RNA-Seq арқылы сандық анықтау жасушалардың дифференциациясы кезінде аннотацияланбаған транскрипттерді және изоформа ауысуын көрсетеді. Табиғат биотехнологиясы. 28, 511–515 (2010).

Краучер, Н.Дж. және Томсон, Н.Р. РНҚ-секв көмегімен бактериялық транскриптомдарды зерттеу. Ақша Опин. Микробиол. 13, 619–624 (2010).

Filiatrault, M. J. Прокариоттық транскриптомиядағы прогресс. Ақша Опин. Микробиол. 14, 579–586 (2011).

Бруно, V. M. және т.б. Адамның саңырауқұлақ қоздырғышының транскриптомының жан-жақты аннотациясы Candida albicans РНҚ қатарын қолдану. Genome Res. 20, 1451–1458 (2010).

Siegel, T. N., Hekstra, D. R., Wang, X., Dewell, S. & Cross, G. A. Өмірлік циклдің екі кезеңдеріндегі мРНҚ көптігін геномдық талдау. Бруцей трипаносомасы және біріктіру мен полиадениляция орындарын анықтау. Нуклеин қышқылдары. 38, 4946–4957 (2010).

Колев, N. G. және т.б. Адам патогенінің транскриптомы Бруцей трипаносомасы бір нуклеотидті ажырату кезінде. PLoS патоги. 6, e1001090 (2010).

Сорбер, К., Димон, М.Т. және ДеРиси, Дж. Л. Сплайсингтің RNA-Seq талдауы Плазмодий фальципарум жаңа түйісу түйіндерін, баламалы түйістіруді және антисезім транскрипттерін қосуды ашады. Нуклеин қышқылдары. 39, 3820–3835 (2011).

Вюрцель, О. және т.б. Патогенді және патогенді емес салыстырмалы транскриптомиясы Листерия түрлері. Мол. Жүйе. Биол. 8, 583 (2012). Қатысты бактериялық транскриптомдар арасындағы айырмашылықтар мен ұқсастықтарды зерттеу үшін RNA-seq қолданатын пионер зерттеуі.

Альбрехт, М., Шарма, С.М., Рейнхардт, Р., Фогель, Дж. & Рудель, Т. Терең реттілікке негізделген ашылым. Хламидиоз трахоматисі транскриптом. Нуклеин қышқылдары. 38, 868–877 (2010).

Альбрехт, М. және т.б. Транскрипциялық ландшафт Chlamydia pneumoniae. Геном Биол. 12, R98 (2011).

Мандлик, А. және т.б. Инфекциямен байланысты өзгерістерді РНҚ-сек негізінде бақылау Тырысқақ вибрионы геннің экспрессиясы. Ұялы хост микробтары 10, 165–174 (2011). Қоян немесе тышқан иелерінен бөлінген бактериялардың патогендік транскриптомдарының сипаттамасы.

Клунан, Н. және т.б. Жаппай масштабты мРНҚ секвенциясы арқылы дің жасушасының транскриптомының профилін жасау. Табиғат әдістері 5, 613–619 (2008).

Ван, Э.Т.т.б. Адам тінінің транскриптомдарындағы альтернативті изоформалық реттеу. Табиғат 456, 470–476 (2008).

Пан, Q., Shai, O., Lee, L. J., Frey, B. J. & Blencowe, B. J. Адам транскриптомындағы альтернативті сплайсинг күрделілігін жоғары өнімді секвенирлеу арқылы терең зерттеу. Табиғат Генет. 40, 1413–1415 (2008).

Пенг, З. және т.б. RNA-Seq деректерінің жан-жақты талдауы адамның транскриптомында кең ауқымды РНҚ редакциясын көрсетеді. Табиғат биотехнологиясы. 30, 253–260 (2012).

Schulte, L. N., Eulalio, A., Mollenkopf, H. J., Reinhardt, R. & amp Vogel, J. Қабылдаушы микроРНҚ реакциясын талдау Сальмонеллалар негізгі цитокиндердің бақылауын ашады рұқсат - 7 отбасы ЭМБО Дж. 30, 1977–1989 (2011).

Oosthuizen, J. L. және т.б. Конидиялармен әрекеттесетін тыныс алу жолдарының эпителий жасушаларының қосарланған транскриптомикасы Aspergillus fumigatus. PLoS ONE 6, e20527 (2011).

Lovegrove, F. E. және т.б. Бір мезгілде хост пен паразитті экспрессиялау профилактикалық церебральді безгекке сезімталдықпен немесе қарсылықпен байланысты тіндерге тән транскрипциялық бағдарламаларды анықтайды. BMC Genomics 7, 295 (2006).

Guerfali, F. Z. және т.б. Инфекцияланған адам макрофагтарындағы бір мезгілде гендік экспрессия Майор Лейшмания SAGE қолданатын паразиттер. BMC Genomics 9, 238 (2008).

Мацумура, Х. және т.б. SuperSAGE көмегімен өсімдіктер мен патогендердің өзара әрекеттесуіне гендік экспрессиялық талдау. Проц. Natl Acad. Ғылым. АҚШ 100, 15718–15723 (2003).

Тирни, Л. және т.б. РНҚ-ның бір мезгілінде алынған түраралық реттегіш желі Candida albicans туа біткен иммундық жасушаларға ену. Алдыңғы. Микробиол. 3, 85 (2012). Эукариот иесі мен эукариоттық қоздырғышты РНҚ-сек арқылы параллель талдауды сипаттайтын алғашқы зерттеу.

Кокс, M. L. және т.б. РНҚ сапасы мен пайдалылығының фиксаторлық әсерінен болған өзгерістерді микроэлементтерді талдау арқылы зерттеу. Мерзімі Мол. Патол. 84, 156–172 (2008).

Eulalio, A., Schulte, L. & Vogel, J. Сүтқоректілердің микроРНҚ-ның бактериялық инфекцияларға реакциясы. РНҚ биол 9, 742–750 (2012).

Wang, K.C & amp Чанг, H.Y. Ұзын кодталмаған РНҚ молекулалық механизмдері. Мол. Ұяшық 43, 904–914 (2011).

Чен, Дж. және Вагнер, E. J. snRNA 3′ соңы қалыптасуы: Интегратор кешенінің таңы. Биохимия. Soc. Транс 38, 1082–1087 (2010).

Браткович, Т. & amp Рогель, B. Кіші нуклеолярлық РНҚ биологиясы мен қолданылуы. Ұяшық Мол. Өмір туралы ғылым. 68, 3843–3851 (2011).

Папенфорт, К. & amp Фогель, J. Бактериялық қоздырғыштардағы реттеуші РНҚ. Ұялы хост микробтары 8, 116–127 (2010).

Кларк, МБ және т.б. Ұзақ кодталмаған РНҚ тұрақтылығының геномдық талдауы. Genome Res. 22, 885–898 (2012).

Янг, Э. және т.б. Адамның мРНҚ-ларының ыдырау жылдамдығы: функционалдық сипаттамалармен және реттілік атрибуттарымен корреляция. Genome Res. 13, 1863–1872 (2003).

Armor, C. D. және т.б. cDNA синтезі үшін селективті гексамер праймингінің көмегімен цифрлық транскриптомды профильдеу. Табиғат әдістері 6, 647–649 (2009).

Chen, Z. & amp Дуан, X. Рибосомалық РНҚ-ны жаппай параллельді қолдану үшін рибосомалық РНҚ-ның сарқылуы. Мол әдістері. Биол. 733, 93–103 (2011).

Хуанг, Р. және т.б. RNA-Seq стратегиясы толық кодталған және кодталмаған транскриптомды, оның ішінде макро ncRNA толық басылған. PLoS ONE 6, e27288 (2011).

Giannoukos, G. et al. Өсірілген бактериялар мен күрделі қауымдастық транскриптомдары үшін тиімді және сенімді РНҚ-секв процесі. Геном Биол. 13, R23 (2012).

Knoop, V. ДНҚ-ға сену мүмкін болмаған кезде: РНҚ өңдеу транскрипт тізбегін өзгертеді. Ұяшық Мол. Өмір туралы ғылым. 68, 567–586 (2011).

Кантара, В.А. және т.б. РНҚ модификациясының дерекқоры, RNAMDB: 2011 жаңартуы. Нуклеин қышқылдары. 39, D195–D201 (2011).

Ishitani, R., Yokoyama, S. & Nureki, O. РНҚ модификациялау ферменттерінің құрылымы, динамикасы және қызметі. Ақша Опин. Құрылым. Биол. 18, 330–339 (2008).

Моторин, Ю., Мюллер, С., Бехм-Ансмант, I. & amp Бранлант, C. РНҚ-ларда өзгертілген қалдықтарды кері транскрипцияға негізделген әдістермен анықтау. Әдістері Энзимол. 425, 21–53 (2007).

Findeiss, S., Langenberger, D., Stadler, P. F. & amp; Hoffmann, S. Терең реттілік деректерінде пост-транскрипциялық РНҚ модификациясының іздері. Биол. Химия 392, 305–313 (2011).

Iida, K., Jin, H. & Zhu, J. K. Биоинформатика талдауы тРНҚ мен миРНҚ-ның негізгі модификациясын ұсынады. Arabidopsis thaliana. BMC Genomics 10, 155 (2009).

Эбхардт, H. A. және т.б. Кішкентай РНҚ-тізбектеу қателіктерінің мета-анализі барлық жерде пост-транскрипциялық РНҚ модификациясын көрсетеді. Нуклеин қышқылдары. 37, 2461–2470 (2009).

Левин, Дж. З. және т.б. Жіптік спецификалық РНҚ секвенирлеу әдістерінің кешенді салыстырмалы талдауы. Табиғат әдістері 7, 709–715 (2010). RNA-seq эксперименттерінде тізбекті арнайы ақпаратты сақтауды қамтамасыз ету үшін қолданылатын қазіргі әдістерге толық шолу.

Пархомчук, Д. және т.б. Комплементарлы ДНҚ тізбегі бойынша транскриптомды талдау. Нуклеин қышқылдары. 37, e123 (2009).

Бородина, Т., Аджайе, Дж. & Сұлтан, М. РНҚ тізбектеуге арналған арнайы кітапхананы дайындау хаттамасы. Әдістері Энзимол. 500, 79–98 (2011).

Крочер, Н.Ж. және т.б. Illumina технологиясын қолдана отырып, транскриптомды бағыттаудың қарапайым әдісі. Нуклеин қышқылдары. 37, e148 (2009).

Мунафо, Д.Б. және Робб, Г.Б. Кішкентай РНҚ-дан кДНҚ өкілдік пулдарын құру үшін ферментативті реакция жағдайларын оңтайландыру. РНҚ 16, 2537–2552 (2010).

Tarazona, S., Garcia-Alcalde, F., Dopazo, J., Ferrer, A. & Conesa, A. RNA-seq-тегі дифференциалды өрнек: тереңдік мәселесі. Genome Res. 21, 2213–2223 (2011). Сүтқоректілерде гендердің экспрессиясын дәл анықтау үшін қажет реттілік тереңдігін зерттеу.

McIntyre, L. M. және т.б. РНҚ-сек: техникалық өзгергіштік және іріктеу. BMC Genomics 12, 293 (2011).

Цзян, Л. және т.б. RNA-seq эксперименттері үшін синтетикалық өсу стандарттары. Genome Res. 21, 1543–1551 (2011).

Garber, M., Grabherr, M. G., Guttman, M. & Trapnell, C. RNA-seq көмегімен транскриптомды аннотациялау және сандық анықтау үшін есептеу әдістері. Табиғат әдістері 8, 469–477 (2011).

Мэлоун, Дж. & Оливер, Б. BMC Biol. 9, 34 (2011).

Metzker, M. L. Секвенирлеу технологиялары - келесі ұрпақ. Табиғат рев. Генет. 11, 31–46 (2010). Танымал NGS платформаларының жұмыс принциптеріне, өнімділігіне және шығындарына шолу, үшінші буынның секвенирлеу әдістеріне көзқарасы бар.

Чжан, Дж., Чиодини, Р., Бадр, А. және Чжан, Г. Келесі ұрпақ секвенирлеуінің геномикаға әсері. Дж. Генет. Геномика 38, 95–109 (2011).

Ротберг, J. M. және т.б. Оптикалық емес геномды секвенирлеуге мүмкіндік беретін біріктірілген жартылай өткізгіш құрылғы. Табиғат 475, 348–352 (2011).

Сэм, Л.Т. және т.б. Қатерлі ісік транскриптомдарының бір молекуласы мен күшейтуге негізделген реттілігін салыстыру. PLoS ONE 6, e17305 (2011).

Корен, С. және т.б. Гибридтік қатені түзету және жаңадан бірмолекулалы тізбекті жинау. Табиғат биотехнологиясы. 30, 693–700 (2012).

Кларк, Дж. және т.б. Бір молекулалы нанопорлы ДНҚ тізбектелуінің үздіксіз негізін анықтау. Табиғат нанотехнологиясы. 4, 265–270 (2009).

Бленкоу, Б.Ж., Ахмад, С. & Ли, Л.Ж. Қазіргі кездегі жоғары өткізу қабілеттілігі: сүтқоректілер транскриптомдары туралы түсінікті тереңдету. Genes Dev. 23, 1379–1386 (2009).

Antoniou, E. & amp Taft, R. RNA-Seq тінтуір ооциттеріндегі гендік экспрессия. Мол әдістері. Биол. 825, 237–251 (2012).

Лао, К.К. және т.б. mRNA-тізбектеу, SOLiD жүйесіндегі бір жасушаның бүтін транскриптомдық талдауы. J. Биомол. Техника 20, 266–271 (2009). Бір жасушалы анализді РНҚ-сегмен сәтті үйлестіретін алғашқы зерттеу.

Танг, F. және т.б. Бір жасушаның транскриптомдық ландшафтын түсіру үшін RNA-Seq талдауы. Табиғат хаттамасы. 5, 516–535 (2010).

Тан, Ф., Лао, К & amp Сурани, М.А. Бір жасушалы транскриптомдық анализдің дамуы мен қолданылуы. Табиғат әдістері 8, S6 – S11 (2011). Бір жасушалы РНҚ-ға қойылатын талаптарға шолу.

Танг, F. және т.б. Эмбриональды бағаналы жасушалардың ішкі жасушалық массасынан бір жасушалы РНҚ-Сексті талдау арқылы шығуын қадағалау. Жасуша бағаналы жасуша 6, 468–478 (2010).

Тан, Ф. және т.б. Жалғыз тышқан бластомерлеріндегі детерминистикалық және стохастикалық аллельдік спецификалық ген экспрессиясы. PLoS ONE 6, e21208 (2011).

Ислам, С. және т.б. Бір жасушалы транскрипциялық ландшафттың жоғары мультиплексті РНҚ-сек. Genome Res. 21, 1160–1167 (2011).

Рамскольд, Д. және т.б. РНҚ мен жеке айналымдағы ісік жасушаларының бір жасушалы деңгейлерінен толық ұзындықтағы mRNA-Seq. Табиғат биотехнологиясы. 22 шілде 2012 (doi: 10.1038/nbt.2282).

Кан, Ю. және т.б. Транскриптомды талдау үшін бір бактериядан транскриптті күшейту. Genome Res. 21, 925–935 (2011). Сэнгер секвенциясы арқылы бір бактериялық жасушадағы дифференциалды ген экспрессиясын бақылауға арналған бірінші зерттеу.

Brouzes, E. Бір жасушалық талдауға арналған тамшы микрофлюидтері. Мол әдістері. Биол. 853, 105–139 (2012).

Коннелл, J. L. және т.б. Прокариоттық әлеуметтік мінез -құлықты бактериялық «омар тұзақтарымен» тексеру. mBio 1, e00202-10 (2010).

Декарло, К., Эмли, А., Дадзи, О.Э. & Махалингам, М. Лазерлік микродисекция: әдістер мен қосымшалар. Мол әдістері. Биол. 755, 1–15 (2011).

Озсолак, Ф. және т.б. Жасушалардың минуттық мөлшерлерінен күшейтусіз сандық ген экспрессиясының профилі. Табиғат әдістері 7, 619–621 (2010).

Линнарссон, С. ДНҚ секвенирлеу әдістерінің соңғы жетістіктері – үлгіні дайындаудың жалпы принциптері. Мерзімі Ұяшық рез. 316, 1339–1343 (2010).


Реферат

Микроглиалды зерттеулерде бір жасушалы РНҚ секвенирлеуін (scRNA-seq) пайдалану қарқынды түрде артып келеді. Бұл тәсілдің негізгі жұмыс процесі бір ұяшықтарды оқшаулау, содан кейін реттіліктен тұрады. scRNA-seq жасушалық деңгейде микроглиальды гетерогенділікті зерттеуге қабілетті. Дегенмен, осы әдістемені қолдану нәтижесінде алынған нәтижелер реттелген ұяшықтардың саны мен реттілік тереңдігі сияқты қолданбалы әдістер сипаттамалары арасындағы айырмашылықтарға байланысты сәйкессіздіктерге ұшырайды. Бұл шолу осы салада болған соңғы оқиғаларды және олардың қолданылатын әдістермен қалай байланысты екенін көбірек көрсетуге бағытталған. Ол үшін біз қазіргі кезде қол жетімді scRNA-seq әдістерінің барысы мен шектеулерін бақылаймыз. Содан кейін шолуда микроглия саласындағы scRNA-seq көмегімен алынған қазіргі білім жинақталады, оның ішінде гомеостаз жағдайындағы функция мен дамуға байланысты жаңа субпопуляциялар, сонымен қатар Альцгеймер, липополисахарид реакциясы және АИТВ сияқты қолданылатын бірнеше патологиялық жағдайлар кезінде. Біздің шолуымыз осы әдістемені қолдануда үлкен жетістіктерге қарамастан, scRNA-seq-тің қазіргі әдістері жоғары бағадан, төмен кірістіліктен және алынған деректердің стандартты еместігінен зардап шегетінін көрсетеді. ScRNA-seq әдістерінің қосымша дамуы сау және патологиялық жағдайда микроглияның біртектілігі мен пластикасы туралы біздің хабардарлығымызды арттырады.


Материалдар мен тәсілдер

Жасуша мәдениеті

HeLa, HCT116 және HEK293T жасушалары Дульбекконың модификацияланған бүркіт ортасында (DMEM) жаңа туған сиырдың сарысуы мен 100 U пенициллин/стрептомицинмен (Гиклон) 37 ° C температурада 5% СО -да инкубацияланды.2. PTBP1 siRNA HeLa жасушалық желісі [27] -де сипатталған.

Poly (A) -seq кітапханасының генерациясы мен реттілігі

Жалпы РНҚ Тризолмен алынды және ДНҚ -ны жою үшін RQ1 DNase (Promega) өңделді. Тазартылған РНҚ сапасы мен саны Smartspec Plus (BioRad) көмегімен 260нм/280нм (A260/A280) абсорбцияны өлшеу арқылы анықталды. РНҚ -ның тұтастығы 1,5% агарозды гель электрофорезімен расталды. Содан кейін жалпы РНҚ 3 минут ішінде 37 ° C температурада RNase T1 фрагменттелді. Әрбір үлгі үшін Poly (A) -seq кітапханасын дайындау үшін бөлшектелген жалпы РНҚ 5,1 мкг пайдаланылды. Полиаденилденген мРНҚ олиго (dT) конъюгацияланған магнитті бисермен (Invitrogen) түсірілді. Сонымен қатар, 3 'адаптерлер GnomeGen sRNA-seq кітапханасына дайындық жиынтығының көмегімен түсірілген мРНҚ-ның 3-ұшына қосылды. Содан кейін кері транскрипция 3 'адаптермен толықтырылған RT праймерімен орындалды, содан кейін ScriptSeq ™ v2 RNA-Seq кітапханасына дайындық жиынтығын (эпицентрі) пайдаланып Терминалды-тегтеу олигосымен ДНҚ синтезделді. ЦДНҚ тазартылды және ПТР 18 циклмен күшейтілді. 250-350 bps және 300-500 bps екі өлшем диапазонына сәйкес ПТР өнімдері тазартылды, мөлшерленді және қолданылғанға дейін -80 ° C температурада сақталды. Өтімділігі жоғары секвенирлеу үшін кітапханалар өндірушінің нұсқаулары бойынша дайындалды және 300 nt бір жақты реттілік үшін Illumina NextSeq 500 жүйесіне қолданылды. Бастапқы реттілік деректеріне GSE84287 бойынша қол жеткізуге болады.

PA-finder: Poly (A) -сегіздік деректерді өңдеу

Poly (A) -seq деректерді өңдеу құбыры 2А суретте көрсетілген. Негізгі қоңыраулар NextSeq 500 бағдарламасынан NextSeq Control Software 1.4 көмегімен алынды. Poly(A)-seq шикі оқуларынан poly(G) және 5', 3' адаптер тізбегін кесіп тастағаннан кейін біз алдымен оқылымдағы поли(A) аймақтарын іздедік. Біз іздеуді толық оқылымдарды сканерлеу және 5' соңына ең жақын бірінші 9A тізбегін (0,1 қателік жылдамдығына рұқсат беру) және 3' соңына ең жақын 6A (0,2 қателік жылдамдығына мүмкіндік беру) табу арқылы бастадық. Арасындағы дәйектілік алдын ала поли (А) аймағы ретінде шығарылды және алдын ала поли (А) аймағы жоқ немесе алдын ала поли (А) & lt 10 nt бар оқулар жойылды. Алдын ала поли(A) аймағын бөліп алғаннан кейін, оқудың 5' соңына қарай қалған реттілік адам геномына (GRCH38) сілтеме жасау үшін картаға түсіру үшін пайдаланылды. Карталау қадамында кемінде 20 nt талап етілді және Tophat2 2 сәйкессіздікке рұқсат беру үшін пайдаланылды. Поли(А) ұзындығын талдау үшін адам геномымен бірегей түрде салыстырылған оқулар сақталды. Содан кейін ұзындығы > = 5 nt болатын кез келген дәйекті А емес тізбектерді белгілеу үшін алдын ала поли(A) аймағын сканерледік. Қатарынан емес As қосылмайтын аймақтағы ең ұзын тізбек поли(A) аймағы ретінде анықталды және ұзындық есептелді. Поли(A) бар тегтің толық реттелгенін анықтау үшін біз өңделмеген оқулардағы поли(A) аймағының төменгі ағынындағы 3' адаптер тізбегін сканерледік.

Бұрын айтылғандай 3 адаптерлік аймақтарға гомополимер сигналының қан кетуін болдырмау үшін [14] біз қосымша сүзгіні қостық. Біз сапа көрсеткішінің күрт төмендеуін көрсететін поли(A) соңғы орнын анықтадық, мұнда үш қатарынан As орташа негізгі сапа ұпайын 25-тен төмен көрсетеді.

Poly (A) -серек пен жарияланған әдістер арасындағы poly (A) профильдеу нәтижелерін салыстыру үшін біз GEO мәліметтер қорынан PAL-seq [8], TAIL-seq [14] және PAT-seq деректерін жүктедік және Poly (A) қолдандық. )-seq деректер сипаттарындағы айырмашылықты қанағаттандыру үшін шағын өзгертулермен осы деректерге деректерді талдау құбыры. Тышқандардан оқиды және С.. cerevisiae үлгілер GRCm38.p3 және S228C сәйкес сілтеме геномдарымен салыстырылды. PAL-seq деректерінде әр тег үшін поли (А) ақпараты болмағандықтан, біз бұл үлгілердегі поли (А) құрамындағы оқулардың арақатынасын талдай алмадық.

Спайк-ин РНҚ дайындау

Құрамында 40-нт поли(А) тізбегі (Tianyi Huiyuan Inc., Ухань) және 120-нт поли(А) тізбегі (IDT, Сингапур) бар ДНҚ олиголары поли(A)-құйрық ұзындығы стандарттарын құру үшін химиялық жолмен синтезделді.

40-нт поли(A) тізбегі 5' соңындағы адаптер тізбегі ( 5'- TAATACGACTCACTATAGGGTTTAACGCGAATTAATTCGTGTGGAATGTGTGTCAGTTAGG- 3' ) және 3' соңындағы адаптер тізбегі ( 5'-CATTGCCGATAGAGTCGACT) арасында орналасқан. 5 -ші адаптер тізбегінде T7 промоторы мен PcDNA3.1 плазмидалық сегментінің сегменті, ал 3 -ші адаптердің тізбегінде BsrD1 кесу тораптарының тізбегі болды. 120-nt поли (A) тізбегі 5 'адаптер тізбегі (5'- TAATACGACTCACTATAGGGTCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTA — 3') мен 3 'адаптерінің реттілігі (5'-CATTGCCTAGAGTCGGACTGA-3') арасында орналасқан. 5-ші адаптер тізбегінде 20-nt T7 промоутерлік тізбегі болды, одан кейін 40-nt немесе 39-nt PcDNA3.1 плазмидалық тізбегі болды, ал 3-ші адаптер тізбегінде BsrD1 кесу алаңы бар, ол толық жоюға мүмкіндік береді. 3 'дейін адаптердің реттілігі in vitro транскрипция

ДНҚ шаблондары in vitro Поли (А) құйрықты РНҚ синтезі T7 промоторының тізбегі (5'- TAATACGACTCACTATAGGG-3 ') және 3' соңғы адаптерлер тізбегіне бағытталған кері праймер (5'- TCAGTCCGACTCTAGGCA -3 ') бар праймер көмегімен күшейтілді. ). ПТР өнімдері VAHTS DNA Clean Beads (Vazyme, N411-03) көмегімен тазартылды, содан кейін BsrD1 (NEB, R0574S) көмегімен кесіліп, 3 'адаптер тізбегін алып тастады, соңында 3' поли (А) құйрық тізбегі қалды. үлгі бойынша. Ферментпен қорытылатын өнім 4,0% агарозды гельде электрофорезден кейін Qiagen баған жинағын пайдаланып гельмен тазартылды. The in vitro транскрипция TranscriptAid T7 жоғары өнімділік транскрипциясы жинағы арқылы жүргізілді (Thermo, K0441). Нәтижесінде 80-нт тітіркендіргіш РНҚ (40-нт адаптер, одан кейін 40-нт поли(А) құйрығы) және 160-нт-тік РНҚ (40-нт адаптер, одан кейін 120-нт поли(А) құйрық) болды. 12% денатурирленген мочевина полиакриламид гелінде тазартылады.

HiSeq X Ten және NovaSeq 6000-дегі Poly (A)-сексі HeLa жасушаларынан жалпы РНҚ мен Spike-in RNA

Әрбір үлгі үшін HeLa жасушаларынан дайындалған 5 мкг жалпы РНҚ қолданылды. Жалпы РНҚ RNase T1 (Thermo, EN0541) арқылы фрагменттелді, содан кейін құрамында поли(A) бар РНҚ фрагменттері олиго(dT)-конъюгацияланған магниттік түйіршіктермен (Invitrogen, 61005) түсірілді. Содан кейін тазартылған спик-ин РНҚ кітапхананы дайындауды жалғастыру үшін қосылды, оған 3' адаптерді байлау (gnomegen, K02420-L) және 3' адаптормен толықтырылған RT праймерімен кері транскрипция кіреді. Екінші тізбекті ДНҚ кейін SMARTer® Stranded RNA-Seq Kit (TAKARA, 634837) көмегімен синтезделді. Кітапханалар Illumina HiSeq X Ten-дегі 150-nt жұпталған жиынтығының көмегімен немесе Illumina NovaSeq 6000 (Novogene, Пекин) 250-nt жұптасқан жиынтығының көмегімен реттелді. Бастапқы реттілік деректеріне GSE84287 бойынша қол жеткізуге болады.

Деректерді талдау кезінде біртұтас 5 'адаптерінің реттілігімен Tophat2 көмегімен сәйкестендіру арқылы полиграфиялық (A) оқулар алынды. Поли (А) құйрығының ұзындығы pA-тапқыш көмегімен есептелді. 120-nt поли (А) құйрықты тізбегі бар 160-нт спикерлі РНҚ үшін оның 1-ші аяғынан 150-нт реттелуі оқулықтар 6-нт кітапханалық реттіліктен, 5-адаптерлер тізбегінің 39-нтінен құралған ( әрбір спик-ин) және 104-nt poly(A) тізбегі үшін бірегей.

NovaSeq Poly (A) -seq оқуларын талдау үшін біз pA-finder-ді бір рет әдепкі параметрлерді қолдана отырып, ал екіншісін жоғарыда сипатталғандай күрт төмендеуді көрсететін poly (A) соңғы орнын анықтау арқылы қосымша сүзгіні қолдандық.

ПТР негізіндегі әдісті пайдалана отырып, поли(A) құйрық ұзындығын өлшеу

To validate the alteration of poly(A) length of individual genes, we used Poly(A) Tail-Length Assay Kit (Affymetrix, 76455) that is based on high resolution poly(A) tail (Hire-PAT) assay [14] as described in the manufacture’s instruction to measure poly(A) length in HeLa cell and HCT116 cell. In brief, total RNA was isolated and guanosine and inosine (G/I) residues were tailed to the 3’ end. The tailed-RNAs are reverse-transcribed using the newly added G/I tails as the priming sites. PCR amplification was performed using two primer sets: (1) a gene-specific forward and reverse primer set designed upstream of the polyadenylation site as a control and (2) a gene-specific forward primer and the universal reverse primer which is provided with the kit to generate a product including poly(A) length. Used gene-specific primers are as follows: NPM1 (forward, 5’-GTTGTCCAAAATGCCTGT-3’ reverse, 5’- ATACTGAGTTTTATTTCACATG-3’ ), ACTB (forward, 5’- AGAATGGCCCAGTCCTCTC-3’ reverse, 5’-AACTGGTCTCAAGTCAGTGTAC-3’ ), and GAPDH (forward, 5’-GCAAGAGCACAAGAGGAAGAG-3’ reverse, 5’- AACTGGTTGAGCACAGGGTA-3’ ). PCR products were detected by polyacrylamide gel electrophoresis.

The poly(A) lengths of the in vitro transcribed 40-nt poly(A)-tail spike-in RNAs were also confirmed by the same method using the spike-in backbone sequence-specific forward primer 5’- GTGGAATGTGTGTCAGTTAGG-3’ .


Overview of RNA-seq

RNA-seq, also known as whole transcriptome shotgun sequencing (WTSS), employs the NGS technologies to sequence cDNA directly from a RNA sample of interest (Morozova et al., 2009 Wilhelm et al., 2008). Transcriptome analysis by RNA-seq is a three-step method, including library construction, sequencing on a specific NGS platform, and bioinformatic analysis (Fig. 1). In the remainder of this section, we will explain each step of a typical RNA-seq experiment and discuss the accompanying challenges and the possible solutions.

ІНЖІР. 1. Illustration of RNA-Seq data analysis pipeline.

Кітапхана құрылысы

The library preparation is a key step for RNA-seq as it determines to a large extent how accurately the final sequencing data reflects the original transcriptome. The first procedure in this step is to collect appropriate samples, usually tissues, to be analyzed. One key concern here is the invariably heterogeneous nature of tissues. This is because tissues typically contain tens or hundreds of unique cell types, and thus, transcriptomic analysis of a tissue confounds the real transcriptomic profiles of its constituent cell types (Islam et al., 2011 Shapiro et al., 2013). One solution to this problem is to analyze single cells rather than cell populations. In fact, various single-cell isolation methods have been developed and already coupled with RNA-seq technology in practice (Shapiro et al., 2013). This single-cell RNA-seq lets many previously impossible applications in both basic and clinical research become possible, such as characterization of the initial differentiation events in embryogenesis (Tang et al., 2009 2010), the investigation of tumor heterogeneity (Dalerba et al., 2011), transcriptomic analysis of rare, transiently existing adult stem cells (Lister et al., 2011), and others.

Following sample collection, total RNA is usually prepared via organic extraction and/or absorption onto silica-membranes of spin columns. Next, RNA is converted to a library of cDNA fragments. Although total RNA can be directly used, total RNA has to be fractionated in most cases. This is because the rRNA, making up more than 80% of total cellular RNA (Lindberg and Lundeberg, 2010), is usually not the research focus, and its presence greatly reduces the useful transcript coverage in the following sequencing step. Total RNA samples are therefore processed either by direct selection of poly(A) RNA or by selective removal of rRNA (ribo-depletion) (Costa et al., 2010). Oligo(dT)-based mRNA purification procedure, widely used in eukaryotes, takes advantage of the presence of a poly(A) tail at the 3′ of eukaryotic mRNA. A large fraction of non-ribosomal RNAs (both coding and noncoding) in eukaryotes, however, lacks the poly(A) tail and is therefore missed (Jacquier, 2009). When compared to the poly(A) RNA selection, the ribo-depletion method is preferred since it enriches all nonribosomal RNA species, including nonpoly(A) mRNA, preprocessed RNA, tRNA, and other ncRNAs with known or unknown functions (Lindberg and Lundeberg, 2010). Although many different rRNA depletion methods have been developed, the two most popular ones are (He et al., 2010 Wilhelm and Landry, 2009): (1) hybridization capture of rRNA by the biotin-labeled anti-rRNA probes, followed by removal with streptavidin-coated magnetic beads and (2) selective degradation of rRNA by a 5′-3′ exonuclease that specifically recognizes rRNA with a 5′ phosphate.

A double-stranded cDNA library is then prepared via either RNA fragmentation (RNA hydrolysis or nebulization) prior to the reverse transcription or reverse transcription first followed by cDNA fragmentation (DNase I treatment or sonication) (Roberts et al., 2011 Wang et al., 2009). The purpose of fragmentation is to reach the desired length for NGS technologies (Metzker, 2009). Each of these two fragmentation methods causes a different bias in final results. Particularly, cDNA fragmentation usually generates an under-representation of the 5′ of the transcripts in the data, while RNA fragmentation allows a good representation of the transcript body but causes depleted transcript ends (Mortazavi et al., 2008 Nagalakshmi et al., 2008). Additionally, the process of reverse transcription can also complicate final RNA-seq data due to the tendency of reverse transcriptase to generate spurious second-strand cDNA and the artificial chimeric transcripts introduced by template switching (Ozsolak and Milos, 2011b).

After the generation of fragmented cDNA, sequencing adapters are ligated to both ends of the fragments. During this process, information about the orientation of transcripts is completely lost. Fortunately, strand-directionality information can be maintained by converting cytidine into uridine with sodium bisulfate (He et al., 2008) the resulting C–T transition position then labels the coding strand of each transcript. Other approaches that maintain the strand specificity are involved with how the adaptors are ligated to the cDNA fragments, and these methods are well reviewed elsewhere (Costa et al., 2010 Marguerat and Bähler, 2010). Like the process of fragmentation, adaptor ligation may also introduce coverage non-uniformity since the fidelities of DNA ligases cannot be guaranteed (Faulhammer et al., 2000).

Кезектілік

The sequencing step relies on the NGS technologies. The three most popular, massively parallel NGS platforms, are currently dominating the NGS market and widely used in RNA-seq, including the 454 pyrosequencing system (a subsidiary of Roche), the AB SOLiD system (Life Technologies), and the Illummina Genome Analyzer (Illumina) (Liu et al., 2012a Marguerat and Bähler, 2010). All these three NGS platforms rely on an in vitro cloning step (clonal amplification) to amplify each fragmented cDNA molecule in a cell-free system, because their sensitivities are not high enough for the single molecule sequencing (Metzker, 2009). Specifically, both the 454 and the SOLiD systems employ an innovative emulsion PCR. In the emulsion PCR, the cDNA fragments from a library are attached to beads and subsequently compartmentalized in the aqueous droplets of a water-in-oil emulsion such that each droplet contains a single DNA molecule the segregated template fragments are then amplified in the tiny aqueous droplets of the emulsion (Dressman et al., 2003). Different from the 454 and the SOLiD systems, the Illummina Genome Analyzer performs a so-called bridge PCR amplification, in which the adapter-linked, single-stranded cDNA fragments are first immobilized on a glass slide by oligonucleotide hybridization in a bridging way, followed by clonal PCR amplification (Adessi et al., 2000 Fedurco et al., 2006). Clonal amplification results in a population of identical templates, each of which is subjected to the following sequencing reaction. Due to PCR artifacts, clonal amplication may introduce bias in the RNA-seq results as well. One way to discriminate PCR artifacts is to perform different biological replicates and determine whether same short reads are concurrently present in different replicates (Wang et al., 2009).

NGS platforms use different sequencing strategies (Metzker, 2009). The sequencing mechanism employed by Roche 454 is pyrosequencing, which is a nonelectrophoretic, bioluminescence-based method (Metzker, 2009 Ronaghi et al., 1998). In brief, every bead, containing the clonally amplified template originating from a single cDNA molecule, is transferred to a ∼29 μm well on a Picotiter Plate (a fiberoptic chip). A mixture of enzymes, such as DNA polymerase, ATP sulfurylase, and luciferase, are also packed into each well. The four DNA nucleotides are added sequentially in a fixed order across the Picotiter Plate during a sequencing run. When one or more complementary nucleotides are added, it generates a light signal that is recorded by the camera in the instrument. The signal strength is proportional to the number of nucleotide added. For the SOLiD system, a mechanism, known as sequencing by ligation (SBL), is used (Landegren et al., 1988 Metzker, 2009 Shendure and Ji, 2008). In its simplest form, after clonal amplification, a sequencing primer is hybridized to template with 3′ at position ‘n’. A set of four fluorescently labeled di-base-encoded probes (8 bp oligonucleotides) then compete for ligation to the sequencing primer. The best-matching probe is linked to the primer by DNA ligase, followed by removal of nonligated probes by wash. Fluorescence imaging is then done to determine the identity of the ligated probe. Following a series of ligation cycles, the extension product is removed and the template is reset with the second sequencing primer with 3′ at the ‘n-1′ position for a second round of ligation cycles. After five rounds of primer reset, each base is examined twice by two different primers, although SOLiD is hence not running as fast as other methods. Last, the method of cyclic reversible termination (CRT) is used by IIIumina (Bentley et al., 2008). CRT is a cyclic sequencing-by-synthesis method that differs from SBL in its use of nucleotide monomer and DNA polymerase. In particular, four types of reversible terminator bases are added in the presence of DNA polymerase and template, and after incubation non-incorporated nucleotides are washed away. Imaging is then performed to determine the identity of the incorporated nucleotide, and, then the dye and the terminal 3′ blocker are chemically removed, allowing for the next cycle to begin. In addition to CRT, ion semiconductor sequencing (Life Technologies) uses a method of “sequencing by synthesis” as well, which is based on the detection of hydrogen ions released during the polymerization of DNA. The major benefits of this method are rapid sequencing speed and low operating costs (Rothberg et al., 2011). Several reviews describing the mechanisms and comparing the advantages and disadvantages of these NGS technologies were published elsewhere (Ansorge, 2009 Liu et al., 2012a Metzker, 2009 Shendure and Ji, 2008).

Despite the popularization of the NGS technologies, the so-called third generation sequencing methods, also known as single-molecule sequencing methods, are on their way. These methods, such as Heliscope sequencing and single-molecule real-time (SMRT) (Pacific Biosciences), are featured by omission of template clonal amplification and real-time signal capture (Liu et al., 2012a). Heliscope sequencing has already been used for a published RNA-seq study (Ozsolak et al., 2010). Additionally, the single-molecule direct RNA sequencing (DRS) technology, developed by Heliscope, is emerging. DRS sequences RNA molecules directly in a massively-parallel manner without biasing sample manipulations such as RNA reverse transcription, ligation, and clonal amplification (Ozsolak and Milos, 2011a). However, these technologies are at varying stages of development and suffer from many drawbacks, such as low single-pass accuracy (81%∼83%), low sequencing efficiency, and low throughput (Niedringhaus et al., 2011 Schadt et al., 2010).

Bioinformatic analysis

After the signal processing, NGS platforms generate millions of short sequences, termed reads, associated with their base-call quality scores that indicate the reliability of each base call. The lengths of these short reads are within a range of 25–450 bp, depending on the type of NGS platform. The resulting reads are categorized into three types: exonic reads, exon–intron junction reads, and poly(A) reads (Fig. 2) (Wang et al., 2009). Although the application of NGS technologies in RNA-seq makes transcriptomic sequences handy, the analysis of the huge amount of RNA-seq data are still the bottleneck for understanding the transcriptome. Fortunately, during the past few years, various bioinformatic tools (software) for RNA-seq data analysis have been developed. Especially, the significance of Bioconductor should be emphasized here. Bioconductor is a free, open source, and open development software project, mainly based on the R programming language, for the analysis and annotation of RNA-seq data and other types of high-throughput genomic data (Gentleman et al., 2004). Most Bioconductor components are organized as R packages. These Bioconductor packages and other software for RNA-seq data analysis have been well reviewed elsewhere (Chen et al., 2011 Febrer et al., 2011 Oshlack et al., 2010). Nowadays, researchers can routinely combine these tools to form the best analysis pipeline per their research interests.

ІНЖІР. 2. Short reads mapping and quantification of the digital signal (modified from Wang et al., 2009). The resulting reads are aligned against a reference genome and fall into three groups, including exonic reads (жасыл), junction reads (red-brown), and poly(A) end reads (көк) (Wang et al., 2009). These reads are used to generate an expression profile with a single-base resolution.

A typical analysis pipeline of RNA-seq data is outline in Figure 1. Quality assessment is the first step for the RNA-seq data analysis. To ensure a coherent final result, low-quality sequences, over-represented sequences, and adapter sequences have to be filtered out, and this step can be accomplished with Bioconductor packages, such as ShortRead (Morgan et al., 2009) and Biostrings (Pages et al., 2009). Once high-quality reads have been obtained, these short reads are subsequently aligned to a reference genome or transcriptome. Alignment is usually done with software outside Bioconductor. In contrast to conventional alignment algorithms, these software are based on the indexing strategies that are able to align millions of short reads in a reasonable period of time (Langmead et al., 2009). Basically, these aligners fall into two categories: one is based on the Burrows-Wheeler transform algorithm, such as Bowtie (Langmead et al., 2009) and BWA (Li and Durbin, 2010), and the other based on Needleman-Wunsch or Smith-Waterman algorithm, such as GNUMAP (Clement et al., 2010), BFAST (Homer et al., 2009), and SHRiMP (Rumble et al., 2009). The aligners in the first category is much faster, the aligners in the second category, however, despite more time needed, are usually more sensitive and generate more reads correctly aligned (Garber et al., 2011). Since many reads span exon–exon junctions and therefore cannot be directly aligned, specialized aligners (spliced aligners), such as Erange (Trapnell et al., 2009) and IsoformEx (Kim et al., 2011), are developed to split the junction reads and then independently align the split read fragments. The methods available to study RNA splicing from short RNA-Seq data have been well reviewed elsewhere (Alamancos et al., 2013). When the reference genome or transcriptome is unavailable, жаңадан transcriptome assembly can be performed (Robertson et al., 2010). Жаңа assembly is used for most fish studies using RNA-seq because only limited fish species have the whole genome information. Жаңа assembly software, for instance, ABySS (Simpson et al., 2009), Velvet (Zerbino and Birney, 2008), and Trinity (Grabherr et al., 2011), use a de Bruijn graph approach, which aligns the user-defined sequence overlap (referred as k-mer) between two reads to create contigs (Grabherr et al., 2011). Transcriptome жаңадан assembly is impeded by the repeats within huge amounts of short reads, alternatively spliced transcripts, as well as biased transcriptome sequencing coverage (Liu et al., 2012b). Therefore, different improvements for the de Bruijn graph approach, such as using various k-mer lengths instead of a single one, have been made to optimize transcriptome assembly (Surget-Groba and Montoya-Burgos, 2010). Besides, a reference proteome or genome from an evolutionarily linked species can be used to aid жаңадан assembly.

Once all reads have been appropriately filtered and mapped or assembled, they can then be counted, and gene expression levels can thus be inferred from the total counts of reads belonging to the exons of a particular gene. In this way, an expression score can be assigned to every base, leading to a genome-scale transcriptome map in terms of quality and quantity (Fig. 2). The single-base (digital) resolution of RNA-seq allows for detection of gene expression at the isoformic and allelic levels and discovery of previously unannotated genes (Jiang and Wong, 2009 Levin et al., 2009 Oshlack et al., 2010 Trapnell et al., 2010). RNA-seq analysis allows not only quantifying gene expression levels within a single RNA sample but also detecting differential expression (DE) across treatments or conditions (Kvam et al., 2012 Oshlack et al., 2010) the latter is usually the real interest of most studies. However, for the DE analysis of RNA-seq data, normalization has to be performed to adjust for between-sample differences such as library size and within-sample gene-specific features regarding GC content and gene length (Dillies et al., 2012 Kvam et al., 2012). There is no standard method to detect DE due to the short history of RNA-seq technology. The currently popular tools for DE analysis in Bioconductor include edger (Robinson et al., 2010), DESeq (Anders and Huber, 2010), baySeq (Hardcastle and Kelly, 2010), and tweeDEseq (Esnaola et al., 2013), and methods, not included in Bioconductor, also exist, such as ShrinkBayes (Van De Wiel et al., 2013) and TSPM (Auer and Doerge, 2011). These DE analysis tools have already been reviewed in detail and well compared in their gene ranking performances (Dillies et al., 2012 Kvam et al., 2012 Soneson et al., 2013). In addition, RNA-Seq analysis can also enable us to detect SNPs, fusion genes, and post-transcriptional gene regulation, such as RNA editing, RNA degradation, and RNA translation (Marguerat and Bähler, 2010).


Алғыс хаттар

Қаржыландыру

HD was funded by a National Science Foundation Graduate Research Fellowship RHC and JAK by the NIH (1U01MH098937) JE and JK by the NIH (5U01MH098953-04) KZ by the NIH (U01MH098977).

Availability of data and material

The dataset supporting the conclusions of this article is available in the NCBI’s Gene Expression Omnibus repository, [GEO: GSE88850]. Code used is available upon request to the corresponding author. Correspondence and material requests should be addressed to Junhyong Kim.

Авторлардың үлестері

RHC, JE, JAK, KZ and JK designed the study. HD and JK designed and performed computational analysis. RA, AC, BD, RD, OVE, JF, SAF, JSH, TKK, JMK, MYL, RL, WJM, SM, JN, JS, NS, TS, JMS, CPW, JW, KW, AW, WW and LZ prepared and quality controlled RNA-seq samples, and performed preliminary processing of the sequence data. HD and JK wrote the manuscript. Барлық авторлар соңғы қолжазбаны оқып, мақұлдады.

Бәсекелес мүдделер

Jian-Bing Fan and Neeraj Salathia work for Illumina Inc. This company manufactures the Fluidigm C1 Smart system, one of the protocols tested in this paper. Illumina provided materials and technical support for Fluidigm C1 data used in this paper. Remaining authors have no competing interests.

Жариялауға келісім

Этиканы бекіту және қатысуға келісім


Sequencing by Synthesis (SBS) Technology

Illumina sequencing technology, sequencing by synthesis (SBS), is a widely adopted next-generation sequencing (NGS) technology worldwide, responsible for generating more than 90% of the world's sequencing data. 1 Illumina sequencing instruments and reagents support massively parallel sequencing using a proprietary method that detects single bases as they are incorporated into growing DNA strands.

A fluorescently labeled reversible terminator is imaged as each dNTP is added, and then cleaved to allow incorporation of the next base. Since all 4 reversible terminator-bound dNTPs are present during each sequencing cycle, natural competition minimizes incorporation bias. 2018-05-07 121 2

The end result is true base-by-base sequencing that enables accurate data for a broad range of applications. The method virtually eliminates errors and missed calls associated with strings of repeated nucleotides (homopolymers).

Секвенция технологиясы бейне

Further Advantages of SBS Technology

Illumina sequencing by synthesis technology supports both single-read and paired-end libraries. SBS technology offers a short-insert paired-end capability for high-resolution genome sequencing, as well as long-insert paired-end reads for efficient sequence assembly, жаңадан sequencing, and more.

The combination of short inserts and longer reads increases the ability to fully characterize any genome.

Illumina Sequencing Introduction

This overview describes major sequencing technology advances, key methods, the basics of Illumina sequencing chemistry, and more.


Бейнені қараңыз: Кітапханатану (Желтоқсан 2022).