Ақпарат

EcoRI шектеу орны қалай реттелген?

EcoRI шектеу орны қалай реттелген?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

EcoRI - GAATTC шектеу аймағының тізбегі 1970 жылдардың басында, Sanger Sequencing ойлап табылғанға дейін анықталды.(1977)

EcoRI шектеу орны қалай реттелген?


Рестрикциялық эндонулеазаны тану аймағын бірінші рет анықтау туралы хабарланды:

Kelly & Smith (1970) Hemophilus influenzae II-ден шектеу ферменті. Тану сайтының негізгі реттілігі. J Mol. Биол. 51: 393-409

Содан кейін фермент эндонуклеаза R деп аталды, бірақ қазір HindII (немесе HincII) деп аталады.

Қолданылған әдіс ДНҚ-ны ферментпен кесіп, содан кейін сілтілі фосфатазамен экспозицияланған терминал фосфаттарын жою болды. Содан кейін бұл ұштарды белгілеуге болады 32P полинуклеотидкиназа және γ-таңбаланған ATP көмегімен.

Соңында таңбаланған ДНҚ мононуклеотидтерді, динуклеотидтерді және тринуклеотидтерге байытылған қоспаны шығару үшін үш түрлі әдіспен нуклеазалармен өңделді. Әрбір жағдайда таңбаланған өнімдер 2D жұқа қабатты хроматографияда олардың мінез-құлқы бойынша анықталды және қажет болған жағдайда мононуклеотидтерге дейін қорытылғаннан кейін олардың жалпы негізгі құрамы үшін әрі қарай сипатталды.

Шығарылған сайт болды/болды

5'----GTY RAC----3' 3'----CAR YTG----5'

Осылайша таңбаланған мононуклеотидтер A және G (пурин=R), динуклеотидтер GA және АА және т.б.

EcoRI тізбегі іс жүзінде бірдей әдістеме бойынша анықталды және оны хабарлады

Hedgpeth et al (1972) RI эндонуклеазамен шектелген ДНҚ нуклеотидтер тізбегі. Проц. Натл. Акад. Sci USA 69:3448 - 3452

Қосымша:

Сэнгер реттілігі (плюс-минус әдісі) 1970-ші жылдар бойы дамыған болуы мүмкін, бірақ ол шынымен де 80-жылдардың басына дейін ұстанбады. Мысалы, 1979 жылы анықталған бірінші толық плазмида тізбегі pBR322 болды:

Sutcliffe (1979) Escherichia coli плазмидасының pBR322 толық нуклеотидтер тізбегі. CSH симп. Quant. Биол. 43: 77 - 90

"Мен Максам мен Гилберттің (1977) ДНҚ-секвенирлеу әдісін пайдалана отырып, pBR322 плазмидті клондау векторының 4362-нуклеотидті-жұп тізбегін анықтадым. ДНҚ құрылымында тексерілетін болжамдарға әкелетін бірнеше қызықты мүмкіндіктер бар."

Ол кезде қолданылған стандартты секвенирлеу әдісі Максам-Гилберт әдістемесін қолданатын химиялық секвенирлеу болды. Мен 1979 жылы АҚШ-та постдокты бастаған кезде M-G секвенциясы стандартты әдіс болды. Сэнгер секвенциясы шынымен 80-ші жылдардың басында Дж.Мессингтің M13 mp векторларын (және кейінірек pUC плазмидаларын) жасағаннан кейін ғана басталды. Бұл қандай жеңілдік болды: M-G реттілігі өте қиын болды, оны жасаған кез келген адам куәландырады.


ЭкоRI

ЭкоRI («eco R one» деп айтылады) – түрлерден оқшауланған рестрикциялық эндонуклеаза ферменті E. coli. Бұл ДНҚ қос спиралдарын белгілі бір жерлерде фрагменттерге бөлетін шектеу ферменті, сонымен қатар шектеуді модификациялау жүйесінің бөлігі болып табылады. The Эко фермент атауының бір бөлігі ол оқшауланған түрден шыққан – «E» жалпы атауды білдіреді, ол «Эшерихиа» және «co» түр атауын білдіреді, «coli» - ал R нақты штаммды білдіреді, бұл жағдайда RY13 , және I бұл штаммнан бөлінген бірінші фермент екенін білдіреді.

Молекулярлық биологияда рестриктеуші фермент ретінде қолданылады. ЭкоRI 4 нуклеотидті жабысқақ ұштарын AATT-ның 5' ұштары асып кетуімен жасайды. Фермент кесетін нуклеин қышқылын тану реті G↓AATTC болып табылады, ол CTTAA↓G палиндромдық, комплементарлы тізбегі бар. Басқа шектеу ферменттері, олардың кесілген жерлеріне байланысты, сонымен қатар 3' саңылаулар немесе ешбір саңылаусыз ұштарын қалдыра алады.


Рестрикциялық ферменттер

ДНҚ-ны кесуге болады рестрикциялық эндонуклеазалар ( RE ). Эндонуклеазалар - нуклеин қышқылының полимерін ыдырату арқылы гидролиздейтін ферменттер фосфодиэфир Нуклеин қышқылының магистральындағы фосфат пен пентозаның арасындағы байланыс. Бұл өте күшті коваленттік байланыс, ал әлсіз сутектік байланыстар өзара әрекеттесуін және қос тізбектілігін сақтайды.

Аты айтып тұрғандай, шектеу эндонуклеазалары (немесе шектеу ферменттері) «шектелген” олардың ДНҚ-ны кесу немесе қорыту қабілетінде. Биологтар үшін пайдалы шектеу әдетте болып табылады палиндромиялық ДНҚ тізбегі. Палиндромдық тізбектер - бұл алға және артқа бірдей тізбек. Палиндромдардың кейбір мысалдары: RACE CAR, CIVIC, MAN PLAN A CANAL PANAMA. ДНҚ-ға қатысты бір-біріне қарсы параллельді жүретін 2 жіп бар. Демек, бір тізбектің кері комплементі екіншісіне ұқсас. Молекулалық биологтар сонымен қатар 6 немесе 8 палиндромдарды танитын осы арнайы молекулалық қайшыларды пайдаланады. 6-кескіш немесе 8-кескіштерді пайдалану арқылы тізбектер үлкен созылуларда сирек кездеседі, бірақ жиі пайдалы болу үшін жеткілікті.

EcoRI тұтас жабысқақ ұштар туғызады SmaI үзік ұштарды тудырады

Шектеу ферменттері ДНҚ-ның ковалентті фосфодиэфирлік байланыстарын «жабысқақ/бірікті» ұштарын немесе «доғал» ұштарын қалдыру үшін гидролиздейді. Кесудегі бұл айырмашылық маңызды, себебі EcoRI жабысқақ ұшын ДНҚ -ның бір ферментті кесіндісімен сәйкестендіру үшін оларды қайтадан желімдеу немесе байланыстыру үшін қолдануға болады. Эндонуклеазалар ДНҚ -ны кеседі, лигазалар оларды қайтадан біріктіріңіз. ДНҚ бірге қорытылады EcoRI сіңірілетін ДНҚ -ның басқа бөлігімен байланыстыруға болады EcoRI, бірақ қорытылған бөлікке емес SmaI. Тағы бір өткір кескіш EcoRV тану ретімен GAT | ATC.


CFTR ∆F508 мутациясынан туындаған муковисцидозды анықтау және диагностикалауда HindIII және EcoRI шектеу эндонуклеазаларын қолдану

Муковисцидоз (CF) CFTR ақуызының мутациясынан туындайды, бұл эпителий жасушаларының беткейлері арқылы тұздардың тасымалдануын болдырмайды, бұл шырыштың гиперпродукциясына және ақырында өлімге әкеледі. Бұл тәжірибенің мақсаты 3 жасар науқаста муковисцидозбен ауыратынын анықтау болды. Гипотезада Джеффте CFTR ∆F508 мутациясынан туындаған муковисцидоз болады деп көрсетілген. Джеффтің ДНҚ-сы мен оң/теріс басқару элементтері EcoRI арқылы екі рет кесіліп, өлшемдері 2,150 bp, 2,150 bp және 4,700 bp болатын үш жолақ шығарылады және Джеффтің ДНҚ-сы мен оң бақылау HindIII екі рет шығарған кезде кесіледі деп болжанған. өлшемдері 7 200 бит және 1 800 бит жолақтар. Эксперимент RFLP талдауында EcoRI және HindIII рестрикциялық эндонуклеазаларды қолданды және нәтижелерді агарозды гельде электрофорез арқылы визуалды түрде көрсетті, осы ДНҚ фрагменттерінің молекулалық өлшемі стандартты қисық графиктен алынған теңдеуден есептелді. CFTR ∆F508 мутациясы бар емделушінің ДНҚ оң бақылау ретінде, ал CFTR ∆F508 мутациясы жоқ пациенттің ДНҚ теріс бақылау ретінде қосылды. Эксперимент нәтижелері көрсеткендей, EcoRI арқылы кесілген ДНҚ үлгілерінің барлығы бірдей өлшемді ДНҚ фрагменттерін шығарды, ал Джефф ДНҚ және оң бақылау HindIII арқылы бірдей дерлік кесілген, ал теріс бақылау басқаша кесілген. Бұл нәтижелер гипотезаны қабылдауға әкелді, яғни Джеффке CFTR ∆F508 мутациясынан туындаған муковисцидоз диагнозы қойылды.

Кіріспе

Дені сау адамдарда ағза өкпедегі және тыныс алу жолындағы шырыш деңгейін жоғарылату арқылы респираторлық инфекцияларға жауап береді. Дегенмен, бұл шырыш бактериялар мен бөгде заттарды ұстай алады, сондықтан муковисцидоздың трансмембраналық өткізгіштік реттегіші (CFTR) ақуыз өкпені ылғалдандыру және артық шырышты кетіру үшін хлор иондарын, бикарбонат иондарын және аниондарды қамтитын тұздарды өкпе жасушалары арқылы тасымалдайды (Gentzsch, 2018). Southern және т.б. 2018).

Дегенмен, CFTR генінің 2000-нан астам мутациялары бар, бұл өлімге әкелетін муковисцидоз ауруына әкелуі мүмкін (Southern et al. 2018). Бұл CFTR мутациялары CFTR ақуызына қалай әсер ететініне байланысты бес түрлі сыныпқа топтастырылған: I класс мутациялары генетикалық тізбекке ерте тоқтату кодонын қосу арқылы дисфункционалды CFTR протеинін шығарады, II класс мутациялары әдеттен тыс CFTR протеинін шығарады, олардың көпшілігі ыдырайтын. Өкпенің шырышты қабатына жеткенге дейін жасуша арқылы, III класс мутациялары иондарды эпителиальды өкпе жасушалары арқылы тасымалдай алмайтын CFTR ақуыздарын шығарады, IV класс мутациялары иондарды эпителиальды өкпе жасушалары арқылы тасымалдау қиынға соғатын CFTR протеиндерін шығарады, V класс мутациялары функционалдық CFTR протеині, бірақ әдеттегіден азырақ, сондықтан бұл оның тиімділігін төмендетеді (Southern et al. 2018).

Муковисцидоз жағдайларының 90%-ына жауап беретін CFTR мутацияларының ең көп тарағаны (Куни, 2018) ∆F508 мутация деп аталатын II класс ақауы болып табылады, бұл спецификалық мутация CFTR генінің 508 позициясында фенилаланин жойылған кезде пайда болады (Suaud et т.б. 2011). Бұл өте кең таралған және өлімге әкелетін аутосомды-рецессивті ауру, ол 2000 солтүстік американдықтардың 1-іне немесе дүние жүзінде 70 000 адамға әсер етеді (Cutting, 2015 Southern et al. 2018). Бұл ауру функционалды емес CFTR протеиніне байланысты өлімге әкеледі, бұл бактерияларды ұстайтын, иммундық жүйені әлсірететін, ағзаларды зақымдайтын, қабынуды тудыратын және көбінесе қант диабетіне және/немесе дұрыс тамақтанбауға әкелетін өкпе мен ұйқы безі түтіктерінде шырыш жиналатынын білдіреді, әдетте пациенттер. тыныс алу жеткіліксіздігінен өледі (Cutting, 2015 Southern et al. 2018). Бақытымызға орай, бұл аурудың әсерін жеңілдету және зардап шеккен адамдардың өмірін ұзарту үшін бірнеше емдеу әдістері бар және муковисцидоз тек CFTR геніндегі мутациялардан туындағандықтан, науқастарды сынау және диагностикалау салыстырмалы түрде оңай (Cutting, 2015).

Бұл бір гендік аутосомды рецессивті бұзылулар (Cutting, 2015) полиморфизм деп аталатын популяциядағы CFTR генінің генетикалық вариациясының түрін жасайды (Паре, 2012). Бір мутациялы полиморфизмді диагностикалаудың ең кең тараған әдістерінің бірі – шектеуші фрагмент ұзындығы полиморфизмі (RFLP) талдауы деп аталатын әдіс, ол генетикалық вариацияларды анықтауда зерттеушілерге көмектесу үшін белгілі бір жерлерде ДНҚ тізбегін фрагменттерге кесу үшін шектеу эндонуклеазаларын пайдаланады (Loenen et al. 2014 Sapienza, 2012). Рестрикциялық эндонуклеазалар - бұл прокариоттардың бірнеше түрлерінде табиғи түрде өндірілетін, бірақ зертханалық генетикалық эксперименттерде көптеген қолданбалары бар ферменттер (Pingoud et al. 2014). Рестрикциялық эндонуклеазалар немесе РЕазалар төрт санатқа топтастырылған (I тип, II тип, III тип және IV тип) генетикалық тестілеуде ең жиі қолданылатындар ДНҚ-дағы тану тізбегіндегі немесе оның жанында фосфат жолақтарын ажырату арқылы қызмет ететін II типті РЕазалар. , бұл процесс дәйекті ДНҚ фрагменттерін шығарады (Pingoud et al. 2014 Sapienza, 2012).

II типті РЕазалардың ең түсінікті екеуіне EcoRI және HindIII жатады: Escherichia таяқшасынан табылған EcoRI және HindIII табылған. Haemophilus influenzae rd (Pingoud et al. 2014). Атап айтқанда, EcoRI және HindIII нуклеотидтерді тануының ерекше реттілігін анықтайды және нуклеотидтер арасындағы фосфаттық байланыстарды ажыратады: EcoRI GAATTC-ті таниды және G және A арасындағы фосфаттық байланысты үзеді, сонымен қатар ол бір негіз арқылы кез келген тізбегін таниды және кеседі. жұп, HindIII AAGCTT таниды және екі А арасындағы фосфаттық байланысты үзеді (Loenen et al. 2014 Sapienza, 2012). Бұған қоса, бұл екі РЕаза симметриялы сатылы кесінділерді шығаратындықтан, ДНҚ фрагменттері олардың комплементарлы тізбегіне қосыла алады, бұл генетикалық клондау қосымшалары үшін пайдаланылды (Loenen et al. 2014). EcoRI CF∆F508 мутациясы бар немесе онсыз пациенттің қан немесе сілекей ДНҚ үлгісіне қосылғанда, EcoRI 2,150 bp, 2,150 bp және 4,700 bp болатын үш фрагментті шығару үшін CFTR генін екі рет бөледі. Дегенмен, CF∆F508 мутациясы бар және онсыз пациенттердің қанына немесе сілекейіне ДНҚ үлгісін қосқанда HindIII әртүрлі нәтижелер береді. CF∆F508 мутациясы жоқ пациенттерде HindIII 1500 bp, 5700 bp және 1800 bp болатын үш фрагментті шығару үшін CFTR генін екі рет бөледі. Екінші жағынан, CF∆F508 мутациясы бар емделушілерде HindIII 1500 bp тану ретін анықтамайды, себебі 508 позициядағы фенилаланиннің жойылуы тізбектің қалған бөлігін шатастырады, сондықтан оның орнына HindIII тек өндіру үшін CFTR генін бөледі. 7 200 бит және 1 800 бит болатын екі фрагмент. HindIII мутациясы бар және жоқ пациенттерде әртүрлі нәтижелер беретін себебі, EcoRI бірдей нәтижелер береді, ал HindIII нақтырақ және тек нақты тану ретін анықтай алады, ал EcoRI сәл ерекше емес және аздап өзгерген тізбектерді анықтай алады. RFLP талдау нәтижелерін агарозды гельде электрофорез арқылы талдауға болады, флуоресцентті бояғыш ДНҚ үлгілеріне қосылады, осылайша ол фрагменттердің жүріп өткен қашықтықты анықтау үшін ультракүлгін трансиллюминатор астында флуоресценцияланады. Үлгілердің жүретін қашықтығы олардың ұзындығына пропорционалды, сондықтан маркерлік ДНҚ фрагменттері жүретін қашықтықты олардың молекулалық өлшемін анықтау үшін басқа ДНҚ үлгілері жүріп өткен қашықтықтарды пайдаланатын стандартты қисық сызықтан теңдеу құру үшін пайдалануға болады.

Бұл эксперимент асырап алынған 3 жасар Джефф есімді баланы CFTR ∆F508 мутациясынан туындаған муковисцидозға тексереді. Джеффтің муковисцидозы бар-жоғын анықтау үшін оның ДНҚ EcoRI және HindIII шектеу эндонуклеазалары бар RFLP талдауынан өтеді. Оң бақылау (∆F508 мутациясы бар емделуші) және теріс бақылау (∆F508 мутациясы жоқ пациент) Джефф нәтижелерін бір нәрсемен салыстыру үшін EcoRI және HindIII көмегімен RFLP талдауынан өтеді. RFLP талдауының нәтижелері агарозды гельде электрофорез арқылы көрнекі болады, содан кейін стандартты қисық сызықтан алынған теңдеу ДНҚ фрагменттерінің REases арқылы кесілгеннен кейін молекулалық өлшемдерін есептеу үшін пайдаланылады. Джеффтің муковисцидозы бар-жоғын және оның муковисцидозының қандай мутация түрінен туындағанын анықтау маңызды, сондықтан ол ауыртпалықсыз және ұзақ өмір сүруі үшін ең жақсы емді алады.

Джефф муковисцидозбен ауырады деген болжам бар, өйткені ол муковисцидозбен байланысты бірнеше белгілерді көрсетеді, соның ішінде ысқырықты сырылдар, қышыну, тұрақты жөтел, майлы нәжіс және мұрынның ағуы. Сонымен қатар, CFTR ∆F508 мутациясынан туындаған муковисцидоз аутосомды-рецессивті ауру болғандықтан, оның ата-анасының екеуі де мутацияның тасымалдаушысы болуы мүмкін және ол екі мутацияланған аллельді мұра еткен болуы мүмкін, бұл оның ата-анасында неліктен кистоздың медициналық тарихында болмайтынын түсіндіреді. фиброз.

Егер бұл гипотеза дұрыс болса және Джеффте CFTR ∆F508 мутациясынан туындаған муковисцидоз болса, онда оның ДНҚ-сы EcoRI арқылы екі рет кесілгенде молекулалық салмағы 2,150 bp, 2,150 bp және үш жолақ пайда болады деп болжанады. 4,700 bp және оның ДНҚ-сы HindIII арқылы бір рет кесіліп, молекулалық салмағы 7,200 bp және 1,800 bp болатын екі жолақ пайда болады. Сондай-ақ, бақылау элементтері (∆F508 мутациясы бар және жоқ емделушілер) молекулалық салмағы 2,150 bp, 2,150 bp және 4,700 bp болатын үш жолақты шығару үшін EcoRI арқылы екі рет кесіледі. Демек, Джефф ДНҚ-сы мен ∆F508 мутациясы бар және онсыз емделушілерде EcoRI арқылы кесілген кезде бірдей молекулалық салмағы бар жолақтар болады. Сонымен қатар, оң бақылау (∆F508 мутациясы бар емделуші) молекулалық салмағы 7200 bp және 1800 bp болатын екі жолақты шығару үшін HindIII арқылы бір рет кесіледі. Ал теріс бақылау (∆F508 мутациясы жоқ пациент) молекулалық салмағы 5700 bp, 1800 bp және 1500 bp болатын үш жолақты шығару үшін екі рет кесіледі. Бұл Джефф ДНҚ үлгісін HindIII көмегімен кескенде пайда болатын жолақтардың салмағы бойынша ДНҚ-сы HindIII-мен кесілген ∆F508 мутациясы бар емделушімен бірдей болуы керек және бұл үлгілердің екеуі де HindIII үлгісімен пайдаланылғаннан басқаша болуы керек дегенді білдіреді. ∆F508 мутациясы жоқ пациент.

Материалдар

Бастау үшін алты ДНҚ үлгісі алынды: муковисцидозға (Джефф) сыналған пациенттен екі үлгі, ∆F508 мутациясы бар жеке адамнан екі үлгі және ∆F508 мутациясы жоқ жеке адамнан екі үлгі. ∆F508 мутациясы бар жеке тұлғаның үлгілері бұрын тиісінше EcoRI және HindIII арқылы кесілген болатын, жүктеу бояуы қосылғанша бұл үлгілерге басқа ештеңе қосылмаған. Реакция буфері басқа үлгілермен біріктірілді, содан кейін EcoRI ∆F508 мутациясы жоқ жеке адамның бір ДНҚ үлгісіне және Джефф ДНҚ үлгісінің біріне қосылды. Әрі қарай, HindIII ∆F508 мутациясыз жеке адамның бір ДНҚ үлгісіне және Джефф ДНҚ үлгісінің біріне қосылды. Бұл төрт үлгі 37 градус Цельсийде отыз минут бойы инкубацияланды. 0,8% агароза гелі ерітіндісі агароза, 1x TAE буфері және 10000x Sybr Safe DNA гель бояуымен дайындалды. Бұл ерітінді құю сөресіне бекітілген гель науасына құйылды, тарақ қосылды, содан кейін гель қатаю үшін тоңазытқышқа отыз минутқа қойылды. Тарақты алып тастады, содан кейін қатты гелі бар гель науасын электрофорез камерасына түсіріп, 1x TAE буферіне батырды. Алты ДНҚ үлгісінің әрқайсысына Фиколы бар жүктеу бояуы қосылды. Келесі молекулалық өлшемдердің жолақтарын көрсету үшін бірінші ұңғымаға/жолаққа маркер жүктелді: 12,000 бит, 7,000 б, 3,000 б, 2,500 б, 2,000 б, 1,800 б, және 1,500 б. Содан кейін EcoRI немесе HindIII көмегімен кесілген алты ДНҚ үлгісі бөлек ұңғымаларға жүктелді. Қақпақ электрофорез камерасына заряд теріс жақтан оң ұшына дейін өтетіндей етіп орналастырылды, құрылғы гельдің жарты жолына дейін 120 В кернеуде 45 минут жұмыс істеуге мүмкіндік берді. Гель аппараттан алынып, әрбір бояғыш жүріп өткен қашықтықты өлшеуге болатындай етіп сызғыштың жанындағы УК трансиллюминаторында қаралды. Маркердің өлшемдерінен алынған деректермен стандартты қисық график құрылды. Бұл график жасаған теңдеу алты ДНҚ үлгісінен жолақтардың молекулалық өлшемін жуықтау үшін пайдаланылды. (DeCicco-Skinner, 2019).

Нәтижелер

1-сурет: Ультракүлгін трансиллюминатордың үстіндегі гельді метрикалық сызғыштың жанында көрсету. 1-жолда маркер болды және 7 көрінетін жолақ пайда болды, 2-жолда -E (∆F508 мутациясы жоқ пациенттің ДНҚ-сы, EcoRI-мен кесілген), 3-жолда +E (∆F508 мутациясы бар пациенттің ДНҚ-сы, кесілген EcoRI), 4-жолда JE (EcoRI-мен кесілген Джефф ДНҚ), 5-жолда -H (∆F508 мутациясы жоқ емделушінің ДНҚ, HindIII-мен кесілген), 6-жолда +H (∆F508 бар емделушінің ДНҚ-сы) бар. мутация, HindIII-пен кесілген), 7-жолда JH (HindIII-пен кесілген Джефф ДНҚ) бар. 2, 3 және 4 жолақтардың әрқайсысы үш ұңғымада бірдей дерлік екі жолақты шығарды. Lane 5 төрт топты шығарды. 6 және 7 жолақтар бірдей дерлік екі жолақты шығарды.

Жолақтардың гельде жүріп өткен қашықтығы ұңғыма мен жолақтың түбі арасындағы қашықтықтан өлшенді. 1-жолдың маркерінде бірнеше молекулалық салмақты жолақтар болды: 12000 бит жолағы 21,5 мм жүрді, 7000 бит жолағы 26,5 мм, 3000 бит жолағы 29,2 мм, 2500 бит жолағы 34,40 бит жол жүрді, bp230 мм жүрді. мм, 1800 бит жолағы 40,5 мм, ал 1500 бит жолағы 44,1 мм жүрді (1-сурет). 2-жолға EcoRI көмегімен кесілген ∆F508 мутациясы жоқ пациенттің ДНҚ-сы жүктелді, 2-жолда екі жолақ көрсетілді: біреуі 28,1 мм, екіншісі 35,2 мм жүрді (1-сурет).3-жолға EcoRI көмегімен кесілген ∆F508 мутациясы бар науқастың ДНҚ-сы жүктелді, 3-жолда да екі жолақ болды: біреуі 27,8 мм, екіншісі 36,1 мм жүрді (1-сурет). 4-жолда Джефф ДНҚ жүктелген және EcoRI арқылы кесілген, 4-жолда да алдыңғы екі ұңғымамен бірдей жерде екі жолақ болды: бір жолақ 28,0 мм, екіншісі 35,9 мм жүрді (1-сурет). 5-жолда HindIII-мен кесілген ∆F508 мутациясы жоқ пациенттің ДНҚ-сы жүктелді, 5-жолда 27,8 мм, 35,8 мм, 42,3 мм және 44,1 мм жүретін төрт жолақ болды (1-сурет). 6-жолда HindIII-мен кесілген ∆F508 мутациясы бар науқастың ДНҚ-сы жүктелді, 6-жолда 26,1 мм және 43,5 мм болатын екі жолақ болды (1-сурет). 7-жолда Джефф ДНҚ жүктелген және HindIII арқылы кесілген, 7-жолда 26,0 мм және 43,5 мм жүретін 6 жолаққа өте ұқсас екі жолақ болды (1-сурет).

2-сурет: CFTR ∆F508 мутациясын шектеуді қорыту үшін стандартты қисық сызығын көрсету. Әрбір маркер жолағының молекулалық массасының журналы y осіне, ал әрбір жолақ маркер жүктелген ұңғымадан ауысқан миллиметрдегі қашықтық х осіне сызылған. Бұл деректерден сызықтық тренд сызығы қосылды, ең жақсы сәйкестік сызығының теңдеуі есептелді және көрсетілді (y=-0,0391x + 4,8133), детерминация коэффициенті есептелді және көрсетілді (R^2=0,8987).

1-суреттен жиналған өлшемдер 2-суреттегі стандартты қисық графигін құру үшін пайдаланылды. Сызықтық тренд сызығын қосу ең жақсы сәйкестік сызығының теңдеуін құрады (y=-0,0391x + 4,8133) және 0,8987 анықтау коэффициентін берді. . Алты үлгі үшін әрбір жолақ жүріп өткен қашықтық осы теңдеуге қосылды, содан кейін жолақ өлшемін шамамен есептеу үшін антилог алынды.

1-кесте: CFTR ∆F508 мутациясы бар емделуші және CFTR ∆F508 мутациясы жоқ пациент Джефф үшін EcoRI және HindIII арқылы CFTR ∆F508 мутациясын шектеуді қорыту нәтижелері.
1-кесте: EcoRI немесе HindIII көмегімен кесілген маркер мен алты ДНҚ үлгісі үшін күтілетін және байқалған молекулалық салмақты көрсету. Әрбір үлгі үшін молекулалық салмақ стандартты қисық теңдеуден (y=-0,0391x + 4,8133) есептелді. 2, 3 және 4 жолақтарда өлшемдері өте ұқсас жолақтар болды және мәндер күтілгенге жақын болды. 5 жолағында күтілгеннен көп жолақтар болды. 6 және 7 жолақтарда өте ұқсас және күтілгенге жақын жолақтар болды.

2-суреттегі теңдеуден алты ДНҚ үлгісі үшін бақыланатын жолақ өлшемдері есептелді және 1-кестеге жазылды. Қате мөлшерін сандық анықтауға болатындай бақыланатын жолақ өлшемдері маркер үшін де есептелді. 1-кестеде есептелген молекулалық масса болжанған молекулалық салмақтан өзгеше болатыны көрсетілген, бұл айырмашылық жолақта базалық жұптар көп болған кезде айтарлықтай байқалады. Бұл ДНҚ үлгілері үшін байқалған жолақ өлшемі күтілетін жолақ өлшеміне дәл сәйкес келмеуі керек және мән базалық жұптары аз жолақтар үшін ең дәл болады дегенді білдіреді. EcoRI көмегімен кесілген үш ДНҚ үлгісі үшін (CFTR ΔF508 мутациясы (+E) және (-E) жоқ емделушілер және Джефф (JE)) үшін EcoRI үш жолақ шығару үшін ДНҚ тізбегін екі рет кеседі деп күтілген: 2 150 бит болатын екі жолақ және 4 700 бит болатын бір жолақ. Алайда, бұл үлгілерді бақылау тек екі жолақты анықтады. Науқас -E 2,500 б.б және 5,183 б.п. емделуші +Е 2,522 б.б және 5,325 б.П. емделуші JE 2,568 bp және 5,229 рет есептелген жолақтарға ие болды. Бұл мәндер өте жақын және мәні бойынша бірдей. ДНҚ HindIII арқылы кесілген CFTR ΔF508 мутациясы (-H) жоқ пациент үш жолақ шығару үшін екі рет кесіледі деп күтілген: 1500 bp, 5700 bp және 1800 bp. Дегенмен, ДНҚ төрт жерден кесілгенін көрсететін төрт жолақ байқалды. Бұл 1 227 бит, 1 443 бит, 2 591 бит және 5 325 бит деп есептелген жолақтарды шығарды. CFTR ΔF508 мутациясы (+H) және ДНҚ-сы HindIII-мен кесілген Джефф (JH) бар емделуші 7200 bp және 1800 bp болатын екі жолақ шығару үшін бір рет кесіледі деп күтілген. Іс жүзінде бұл екі үлгі бір рет кесілген, +H пациентінде жолақ өлшемдері 6,206 bp және 1,296 bp болды, ал JH пациентінде жолақ өлшемдері 6,262 bp және 1,296 bp болды. Бұл мәндердің ұқсастығы сонша, жолақ өлшемдерін бірдей деп санауға болады.

Талқылау

Муковисцидоз мутацияларының 2000-нан астам полиморфизмімен CFTR генінің қате болуы мүмкін көп нәрсе бар. CFTR ∆F508 мутациясының мысалында геннің 508-позициясында бір амин қышқылы (фенилаланин) жойылады (Suaud et al. 2011). Бұл позицияда фенилаланиннің жойылуы соншалық, CFTR протеині дисфункцияға ұшырайды, нәтижесінде эпителий беттерінде шырыштың гиперпродукциясы пайда болады (Kreda et al. 2012). CFTR протеині бірнеше эксперименттер арқылы эпителий жасушалары арқылы тұздарды (хлорид иондары мен бикарбонат иондары) және басқа аниондарды тасымалдайтын циклдік аденозин монофосфатқа тәуелді фосфорлану (cAMP) белсендірілген аниондық арна ретінде анықталды (Gentzsch, 2018). Салауатты, толық жұмыс істейтін CFTR протеиндері бұл тұздарды бетті ылғалдандыру арқылы артық шырышты кетіру үшін өкпені және басқа мүшелерді қаптайтын эпителий жасушаларының плазмалық мембранасы арқылы тасымалдайды (Gentzch, 2018 Suaud et al. 2011). CFTR ∆F508 мутациясы жағдайында дұрыс бүктелмейтін CFTR протеині түзілмейді, белок қаттай алмайды, өйткені нуклеотидтерді байланыстыратын домен (NBDI) деп аталатын нуклеотидтерді байланыстыру үшін АТФ әрекеттесетін CFTR бөлімі және төртінші цитозолдық цикл. Басқа ақуызды плазмалық мембранаға бекітетін CFTR басқа бөлімінде (MSD 2) 1070 кодондағы аргинин амин қышқылымен сутектік байланыстар түзеді (Cutting, 2015). Жасуша қате қатпарланған CFTR ақуыздарын анықтайды және олардың көпшілігін эндоплазмалық ретикулумда ыдыратады (Suaud et al. 2011). Бұл CFTR ақуызының өте аз немесе ешқайсысы эпителий жасушаларының бетіне жетпейтінін білдіреді, сондықтан хлорид пен бикарбонат иондары плазмалық мембрана арқылы тасымалдана алмайды (Suaud et al. 2011). Бұл тұз иондары плазмалық мембрана арқылы тасымалданбайтындықтан, тұздар эпителий жасушаларының базальды жағында жоғары концентрацияда болады, бұл апикальды бетінен суды тартып алады және өкпе, асқазан-ішек және ұйқы безі беттерінің сусыздануына әкеледі (Гентзш). , 2018). Бұл мүшелердің апикальды беттерінде су болмаған кезде артық шырышты кетіру мүмкін емес, содан кейін тығыз жабысқақ шырыш кедергілер тудырады және тыныс алу жолдарының аурулары мен қабынуына әкеледі, нәтижесінде пациенттер өліміне әкеледі (Gentzsch, 2018).

Бұл эксперимент EcoRI және HindIII шектеу эндонуклеазаларымен RFLP талдауын қолдану арқылы CFTR ∆F508 мутациясынан туындаған муковисцидозды анықтау үшін 3 жасар Джеффті сынады. Оның нәтижелері оң бақылаумен (∆F508 мутациясы бар пациент) және теріс бақылаумен (∆F508 мутациясы жоқ пациент) салыстырылды, олар да Джефф нәтижелерін бір нәрсемен салыстыру үшін EcoRI және HindIII көмегімен RFLP талдауына енгізілген. RFLP талдауының нәтижелері агарозды гельде электрофорез арқылы көрнекі түрде көрсетілді (1-сурет), содан кейін стандартты қисық сызықтан (2-сурет) теңдеу жасалды, ол ДНҚ фрагменттерінің молекулалық өлшемдерін (1-кесте) есептеу үшін қолданылды. эндонуклеазалар түзіледі. Бұл ерте диагноз Джеффтің ауыртпалықсыз және ұзақ өмір сүруі үшін оған қажетті күтімді алуын қамтамасыз ету үшін өте маңызды. Сонымен қатар, RFLP талдауы 23andMeTM сияқты тұтынушыларға тікелей генетикалық сынақтарға қарағанда аутосомды-рецессивті бұзылыстарды тексерудің әлдеқайда сенімді әдісі болып табылады, өйткені түсінбеушіліктерге орын аз. 23andMeTM сияқты компаниялар тұтынушының генетикалық ақпаратын олардың мутациялар дерекқорымен салыстыру арқылы генетикалық вариацияны өлшейді, бұл дерекқор 715 000 бір нуклеотидті мутацияны анықтай алады (Lu et al. 2017). Бұл дерекқор CFTR генінің 508 позициясында фенилаланин жойылған кезде пайда болатын үш нуклеотидті жоюды анықтайтынын білдіреді. RFLP бұдан ерекшеленеді, өйткені ол генетикалық тізбектерді салыстырмайды, керісінше, тану реті бойынша ДНҚ-ны фрагменттерге кесу үшін шектеуші эндонуклеазаларды пайдаланады, бұл жағдайда пациенттің ДНҚ-сы сол жерлерде кесілген болса, муковисцидоз диагнозын қоюға болады. оң бақылау. 23andMeTM ұсынған генетикалық сынақтардың бір артықшылығы, олар пациенттің рецессивті мутацияның тасымалдаушысы екенін де айта алады, бұл RFLP талдауы жасай алмайтын нәрсе (Lu et al. 2017). Дегенмен, тікелей тұтынушыға генетикалық тестілеуге қатысты ең үлкен алаңдаушылықтардың бірі - адамдардың көпшілігі нәтижелерді қалай түсіндіру керектігін білмейді және генетикалық кеңес алмаудың нәтижесінде қатты мінез-құлыққа ие болуы мүмкін (Паре, 2012), бұл тағы бір себеп. 23andMeTM пайдаланудың орнына RFLP көмегімен муковисцидозды тексеру неге маңызды.

Джеффте CFTR ∆F508 мутациясынан туындаған муковисцидозы бар деген болжам жасалды, өйткені ол аурумен байланысты бірнеше белгілерді көрсетеді. Бұл оның ата-анасының екеуі де CFTR ∆F508 мутациясының тасымалдаушысы болған жағдайда мүмкін болар еді, өйткені тасымалдаушыларда симптомдар болмайды, өйткені ауру тек CFTR генінің осы орналасуындағы екі аллель де мутацияланған кезде пайда болады. Джеффтің ДНҚ-сын EcoRI екі рет кесіп, өлшемдері 2,150 bp, 2,150 bp және 4,700 bp болатын үш жолақ шығарады және оның ДНҚ-сын HindIII кесіп, 7,200 bp және 1800 bp өлшемдері бар екі жолақ шығарады деп болжанған. . Сондай-ақ, EcoRI үлгілері (∆F508 мутациясы бар және онсыз емделушілер) 2,150 bp, 2,150 bp және 4,700 bp өлшемдері бар үш жолақ шығаратын Джефф ДНҚ-сына ұқсас етіп EcoRI арқылы екі рет кесіледі. Джефф ДНҚ-сы мен ∆F508 мутациясы бар және жоқ пациенттердің ДНҚ-сы EcoRI арқылы кесілген кезде өлшемдері бірдей жолақтарға ие болуы керек дегенді білдіреді. Сонымен қатар, оң бақылау (∆F508 мутациясы бар емделуші) 7200 bp және 1800 bp өлшемдері бар екі жолақ шығаратын Джефф ДНҚ-ға ұқсас HindIII арқылы бір рет кесіледі. Бұл теріс бақылаудан (∆F508 мутациясы жоқ пациент) айырмашылығы, ДНҚ екі рет кесіліп, өлшемдері 5,700 bp, 1,800 bp және 1,500 bp болатын үш жолақ пайда болады. Егер гипотеза дұрыс болса, Джефф ДНҚ үлгісін HindIII арқылы кескенде пайда болатын жолақтар салмағы бойынша ДНҚ-сы HindIII-мен кесілген ∆F508 мутациясы бар емделушімен бірдей болады және бұл үлгілердің екеуі де HindIII-мен салыстырғанда әртүрлі болуы керек. ∆F508 мутациясы жоқ науқаста қолданылған.

Оң бақылауды қосудың мақсаты ∆F508 мутациясы бар адамның HindIII шектеу қорыту нәтижелерін визуализациялау, содан кейін Джеффтің ДНҚ қалай кесілгенімен салыстыру үшін болды, егер олар бірдей кесілген болса, онда бұл оның да бірдей екенін білдіреді. CFTR полиморфизмі. Егер оның ДНҚ оң бақылаудан басқаша кесілген болса, онда бұл оның ∆F508 мутациясының жоқтығын білдіреді. Теріс бақылауды қосудың мақсаты ∆F508 мутациясы жоқ адамның HindIII шектеу қорыту нәтижелерін визуализациялау және одан кейін Джефф ДНҚ қалай кесілгенімен салыстыру үшін болды. Егер теріс бақылау оң бақылауға және Джефф ДНҚ-сына қарағанда басқаша кесілген болса, онда бұл оның ∆F508 мутациясының жоқтығын білдіреді. Алайда, егер Джеффтің нәтижелері оң немесе теріс нәтижелерге сәйкес келмесе, бұл эксперимент нәтижелері жарамсыз дегенді білдіреді. Сондай-ақ, HindIII арқылы кесілген кезде оң және теріс бақылаулар бірдей болса, эксперимент нәтижелері жарамсыз болады. Сонымен қатар, RFLP талдауының нәтижелері Джефф үшін және EcoRI көмегімен кесу кезіндегі басқару элементтері үшін бірдей болса да, EcoRI әлі де қосылды, өйткені бұл барлық үлгілер үшін бірдей нәтиже бермесе, эксперимент нәтижелері күмән тудыруы керек.

1-жолға жүктелген маркер гель бойымен сәтті қозғалды (1-сурет) және күтілгендей 12 000 бит, 7 000 бит, 3 000 бит, 2 500 бит, 2 000 бит, 1 800 б. және 1 500 б. (болған) жолақтар шығарды. Әрбір жолақ көшкен қашықтық өлшенді және бұл деректер 0,8987 анықтау коэффициентін және y=-0,0391x +4,8133 теңдеуімен ең жақсы сәйкестік сызығын беретін стандартты қисық алу үшін әрбір молекулалық салмақтың журналына қарсы сызылды (2-сурет) ). Алты үлгі үшін әрбір жолақ жүріп өткен қашықтық осы теңдеуге қосылды, содан кейін жолақ өлшемін шамамен есептеу үшін антилог алынды. Бұл теңдеу маркерлердің өлшемін есептеу үшін, сондай-ақ осы модельде қанша математикалық қате бар екенін анықтау үшін пайдаланылды. 1-кестеде есептелген молекулалық массаның нақты молекулалық салмақтан сәл өзгеше болатыны көрсетілген, бұл әсер ДНҚ-да негіз жұптары көп болған кезде күшейеді. Басқа ДНҚ үлгілерінің нәтижелері жолақтардың күтілетін және бақыланатын молекулалық салмағында кейбір өзгерістерге ие болуы мүмкін екенін және мұндай вариацияның өзінде нәтижелер әлі де жарамды болатынын білдіреді. Бұл теңдеу 1-суреттегі гельде көрсетілген жолақтардың молекулалық өлшемдерін есептеу үшін де пайдаланылды. Егер гипотеза дұрыс болса, Джефф ДНҚ, ∆F508 мутациясы бар пациент және ∆F508 мутациясы жоқ пациенттің барлығы кесіледі. молекулалық салмағы 2,150 б.п., 2,150 б.б. және 4,700 б.б. жолақтар шығару үшін EcoRI арқылы екі рет. Осы жолақтардың екеуі бірдей молекулалық салмақ болғандықтан, гельде тек екі жолақ пайда болады: 2,150 bp және 4,700 bp. Осы ДНҚ үлгілерін бақылау олардың барлығында екі жолақ бар екенін көрсетті (1-сурет – 2,3,4 жолақтар) және стандартты қисық теңдеу бойынша есептеулер үш үлгідегі осы екі жолақтың молекулалық салмағының өте ұқсас екенін көрсетті: JE-де ДНҚ фрагменттерінің өлшемдері -E-де 2,568 bp және 5,229 bp ретінде есептелді жолақтардың өлшемдері +E-де 2,500 bp және 5,183 bp ретінде есептелді жолақтардың өлшемдері 2,522 bp және 5,325 bp ретінде есептелді (1-кесте). EcoRI барлық үлгілерді шамамен бір жерден кесіп тастағандықтан, RFLP талдауы дұрыс жұмыс істеді және эксперименттің басқа нәтижелері де дұрыс жұмыс істеуі керек деп қорытынды жасауға болады. Бұл сонымен қатар CFTR генінің барлық ДНҚ үлгілерінде болғанын білдіреді, өйткені егер үлгілердің кез келгенінде CFTR гені болмаса, үлгілер бірдей ДНҚ фрагменттерін жасамайтын еді. Дегенмен, бұл нәтижелер тек муковисцидоз диагнозын қамтамасыз ете алмайды, өйткені EcoRI ферменті оң және теріс бақылауды бірдей түрде кеседі. Егер EcoRI және оң бақылау Джеффті диагностикалау үшін қолданылған жалғыз нәрсе болса, онда гипотеза қабылданған болар еді, өйткені CFTR гені оң бақылау және Джефф үшін бірдей ДНҚ фрагменттеріне кесілген. Керісінше, егер EcoRI және теріс бақылау Джеффті диагностикалау үшін қолданылған жалғыз нәрсе болса, онда гипотеза қабылданбаған болар еді, өйткені CFTR гені теріс бақылау мен Джефф үшін бірдей ДНҚ фрагменттеріне кесілген. Әлбетте, бұл проблемалық, өйткені гипотезаны қабылдауға да, жоққа шығаруға да болмайды, сондықтан Джеффті муковисцидозбен дәл диагностикалау үшін оң және теріс бақылауды басқаша кесетін шектеу эндонуклеазасын қолдану керек, сондықтан HindIII да қолданылды.

Егер гипотеза дұрыс болса, Джеффтің ДНҚ-сы және ∆F508 мутациясы бар (оң бақылау) пациент молекулалық салмағы 7200 бит және 1800 бит жолақтар шығару үшін HindIII арқылы бір рет кесіледі. Бұл ДНҚ үлгілерін бақылау олардың екеуі де бір рет кесілгенін және екі жолаққа ие екенін көрсетті (1-сурет – 6 және 7 жолақтар) және стандартты қисық теңдеу бойынша есептеулер екі үлгідегі осы екі жолақтың молекулалық салмағының ұқсас екенін көрсетті: JH-де жолақтардың өлшемдері 6,262 bp және 1,296 bp және +H параметрінде жолақтардың өлшемдері 6,206 bp және 1,296 bp ретінде есептелді (1-кесте). HindIII Джефф ДНҚ-сын да, ∆F508 мутациясы бар науқастың ДНҚ-сын да кесіп тастағандықтан, Джеффте муковисцидозды тудыратын ∆F508 мутация болуы мүмкін. Бұл нәтижелердің жарамдылығын растау үшін осы үлгілердің екеуін де теріс бақылаумен – CFTR ∆F508 мутациясы жоқ пациентпен салыстыру қажет. Бақылау нәтижесінде ∆F508 мутациясы жоқ пациенттің ДНҚ-сы (-H) төрт жолақ шығару үшін HindIII арқылы үш рет кесілгені анықталды (1-сурет) және бұл жолақтардың молекулалық салмағы 1,227 bp, 1,443 bp, 2,591 bp болатындай етіп есептелген. , және 5,325 bp (1-кесте). Әлбетте, бұл нәтижелер бұл пациенттің ДНҚ-сы 5,700 bp, 1,800 bp және 1,500 bp молекулалық салмағы бар үш жолақ шығару үшін HindIII арқылы екі рет кесіліп, пациенттің ДНҚ-сы болады деген болжамға сәйкес келмейді. Дегенмен, жоғарғы екі жолақ EcoRI көмегімен кесілген үлгілердің жолақтарымен тураланған сияқты. Бұл үлгі кейбір EcoRI-мен ластанған болуы мүмкін дегенді білдіреді. Бұл нәтижелерді талдауға кедергі келтіреді, алайда бұл жолақтардың басқа HindIII үлгілеріне қатысты орналасуына байланысты кейбір қорытындылар әлі де жасалуы мүмкін. Біріншіден, нәтижелер жеткілікті әртүрлі, сондықтан JH және +H бірдей болды, ал -H әртүрлі болды. Екіншіден, -H үлгісінде +H және JH ең төменгі жолақтан төмен жолақ бар (1-сурет – 5, 6, 7 жолақтар). Гипотеза дұрыс болса, бұл мағыналы болар еді, өйткені -H ең кіші жолағы 1500 бит және +H/JH ең кіші жолақтары 1800 BP болуы керек (1-кесте). Үшіншіден, Джеффтің ДНҚ үлгісін HindIII арқылы 7200 бит-те кесудің жалғыз жолы оның CFTR ∆F508 мутациясына ие болған жағдайда ғана болады (1-сурет және 1-кесте). Сондықтан гипотеза қабылданады, Джеффте CFTR ∆F508 мутациясынан туындаған муковисцидоз бар.

Егер оң бақылау алынып тасталса, диагноз қою өте қиын болады және гипотезаны растау мүмкін емес еді, өйткені Джефф ДНҚ фрагменттерінің есептелген молекулалық мөлшері күтілетін молекулалық өлшемдерден басқаша. Есептелген молекулалық өлшемі де оң бақылаудың ДНҚ фрагменттері үшін күтілетін өлшемнен ерекшеленетінін және бұл фрагменттердің және Джеффтің молекулалық өлшемдері HindIII арқылы кесілгенде бірдей дерлік екенін байқау гипотезаны қабылдауға әкелген соңғы фактор болды. Егер теріс бақылау алынып тасталса, гипотеза әлі де қабылданған болар еді, өйткені Джеффтің ДНҚ-сы әлі де оң бақылауға сәйкес келеді. Алайда, оның муковисцидозы болмаған баламалы сценарийде теріс бақылауды өткізіп алу Джеффтің муковисцидозы жоқ екенін растау мүмкін болмайтынын білдіреді, өйткені оның ДНҚ фрагменттері HindIII арқылы кесілген кезде ештеңеге сәйкес келмейтін еді.

Бұл эксперимент тек Джефф геномының CFTR генін қамтитын сегментін пайдаланды. Егер біз мутациясы бар немесе онсыз пациенттің оның бүкіл геномын пайдаланған болсақ, онда EcoRI және HindIII көптеген тану орындарын (тиісінше GAATTC және AAGCTT) орналастырар еді және осы учаскелерде фосфат топтарын бөлген болар еді, бұл көптеген ДНҚ фрагменттерін шығарар еді. Шындығында, ДНҚ фрагменттері соншалықты көп, сондықтан сіз не қарап жатқаныңызды айту қиын болады, 1-суреттегі бірнеше жолақты көрудің орнына жүздеген жолақтар болуы мүмкін. Бұл Джеффте CFTR мутациясының бар-жоғын анықтау мүмкін емес. ДНҚ-ның белгілі бір аймағын зерттеу үшін бүкіл геномдар пайдаланылса, зертханалық хаттаманы өзгерту қажет болады.Бұған қол жеткізудің бір жолы - оңтүстік блоттинг арқылы: электрофорезден алынған ДНҚ фрагменттері жоғары капиллярлық тасымалдау арқылы мембранаға тасымалданады, содан кейін CFTR тізбегіне сәйкес келетін жолақтарды зондпен анықтауға мүмкіндік беретін иммобилизацияланады (Браун, 2001).

Қорытындылай келе, бұл нәтижелер маңызды, өйткені ол HindIII муковисцидозды диагностикалау үшін өте пайдалы шектеуші эндонуклеаза болып табылады және Джеффтің муковисцидоз диагнозы (CFTR ∆F508 мутациясынан туындаған) ол жеке емдеуді, мысалы, lumacaftor ала алатынын білдіреді. CFTR ∆F508 мутациясынан туындаған қате қатпарланған CFTR протеиндерінің деградациясының алдын алу арқылы Джеффке пайдасын тигізуі мүмкін препарат, бұл белоктардың апикальды эпителий жасушаларының бетіне жетуіне көмектеседі, осылайша функция жартылай қалпына келтіріледі (Kreda et al. 2012). Бұл тәжірибені үлгілердің дұрыс емес шектеу эндонуклеазасымен ластанбағанына көз жеткізу үшін үлгілердің санын екі есе арттыруға және молекулалық өлшемдерді жақсартылған дәлдікпен есептейтін теңдеуді шығаратын басқа тренд сызығын пайдалану арқылы жақсартуға болады. Болашақ зерттеулер оң және теріс бақылауларда CFTR-ді қалай кесетінін көру үшін BamHI, EcoRII, Hand HaeIII сияқты басқа шектеу эндонуклеазаларының қолданылуын зерттей алады.

Анықтамалар

Браун, Т (2001) Southern Blotting. Curr Protoc Immunol 10(6a).

Куни, А.Л., П.Б. МакКрей кіші және П.Л. Синн (2018) Муковисцидоздың гендік терапиясы: артқа қарау, алға қарау. Гендер (Базель) 9(11).

Cutting, G. R. (2015) Муковисцидоздың генетикасы: молекулалық түсініктен клиникалық қолдануға дейін. Nat Rev Genet 16(1): 45-56.


CBSE 12 сыныбына арналған маңызды сұрақтар Биологияның биотехнология принциптері және рекомбинациялық ДНҚ технологиясының құралдары

1. Биотехнология микроорганизмдерді, өсімдіктерді немесе жануарлар жасушаларын немесе олардың компоненттерін адамдарға пайдалы өнімдер мен процестерді өндіру үшін пайдалану ретінде анықтауға болады. Еуропалық биотехнология федерациясына (EFB) сәйкес биотехнология - бұл табиғи ғылымдар мен ағзаларды, жасушаларды, олардың бөліктерін және өнімдер мен қызметтерге арналған молекулалық аналогтарды біріктіру. «Биотехнология» терминін 1919 жылы Карл Эреки енгізген.
2. Биотехнологияның принциптері келесі әдістемелердің тұжырымдамасына негізделген:
(i) Гендік инженерия Бұл генетикалық материалдың (ДНҚ/РНҚ) химиясын өзгерту, оларды басқа ағзаларға енгізу және осылайша қабылдаушы ағзаның фенотипін өзгерту әдісі.
(ii) антибиотиктер, вакциналар, ферменттер және т.б. сияқты биотехнологиялық өнімдерді өндіру үшін тек қажетті микробтардың/эукариоттық жасушалардың үлкен көлемде өсуін қолдау үшін стерильді жағдайларды тиісті түрде сақтау.

3. Гендік инженерия әдістеріне мыналар жатады:

  • құру рекомбинантты ДНҚ қажетті гендерді біріктіру арқылы.
  • Генді тасымалдау.
  • Хост пен генді клондаудағы ДНҚ-ның сақталуы.
  • Гендік инженерияның негізгі қадамдарын былайша қорытындылауға болады:
  • Қажетті гендермен ДНҚ-ны анықтау.
  • Анықталған ДНҚ-ны иесіне енгізу.
  • Иеде енгізілген ДНҚ-ны сақтау және ДНҚ-ны оның ұрпақтарына беру.

4. Бірінші жасанды рекомбинантты ДНҚ құрылысы
(i) Антибиотиктерге төзімділікті кодтайтын генді жергілікті адаммен байланыстыру арқылы қол жеткізілді плазмида Salmonella typhimurium (автономды репликацияланатын шеңберден тыс хромосомалық ДНҚ).
(іі) Стэнли Коэн және Герберт Бойер мұны 1972 жылы орындады.
(iii) Олар плазмидадан ДНҚ бөлігін кесіп алу арқылы антибиотиктерге төзімділік генін бөліп алды.
(iv) ДНҚ-ны белгілі бір жерлерде кесуді жүзеге асырды молекулалық қайшылар, яғни. шектеу ферменттері.
(v) ДНҚ-ның кесілген бөлігі ДНҚ ферментімен плазмидтік ДНҚ-мен байланысқан. лигаза. Плазмидті ДНҚ ретінде әрекет етеді векторлар оған бекітілген ДНҚ бөлігін тасымалдау үшін.
(vi) Бұл ДНҚ колиге ауысқанда, ол жаңа хосттың ДНҚ-полимераза ферментінің көмегімен репликациялануы және бірнеше көшірме жасауы мүмкін.
(vii) Бұл антибиотикке төзімділік генінің көшірмелерін көбейту мүмкіндігі Е. coli деп аталды клондау E. coli-дегі антибиотиктерге төзімділік гені.

5. Рекомбинантты ДНҚ технологиясының құралдары төмендегідей:
(i) шектеу ферменттері (ii) полимераз ферменттері
(iii) Лигазалар (iv) Векторлар
(v) Құзыретті иесі ағза.

6. ДНҚ кесу үшін рестрикциялық ферменттер немесе «молекулярлық қайшылар» қолданылады.
(i) 1963 жылы бактериофагтың өсуін шектеуге жауапты E. coli-ден екі фермент бөлініп алынды, олардың біреуі ДНҚ-ға метил тобын қосты, ал екіншісі ДНҚ-ны сегменттерге бөлді. Кейінірек рестрикциялық эндонуклеаза деп аталды.
(ii) Hind II шектеуінің бірінші эндонуклеазасын Смит Вилкокс пен Келли (1968) бөліп алған. Олар тану тізбегі деп аталатын алты негізгі жұптың белгілі бір тізбегін тану арқылы әрқашан белгілі бір нүктеде ДНҚ молекулаларын кесетінін анықтады.
(iii) Hind II-ден басқа, қазір 230-дан астам бактерия штаммдарынан 900-ден астам шектеу ферменттері бөлініп алынды, олардың әрқайсысы әртүрлі тану ретін таниды.
(iv) Шектеу ферменттерін атау
(а) Бірінші әріп тұқым атауынан және келесі екі әріп ферменттер алынатын прокариоттық жасушаның түр атауынан алынған.
(b) Атаудан кейінгі римдік сандар ферменттердің бактерия штаммынан бөлінген ретін көрсетеді.
Мысалы, Eco RI ішек таяқшасынан RY13, ал Eco RII E. coli R 245 және т.б.
(v) Рестрикциялық ферменттер деп аталатын ферменттер класына жатады Нуклеазалар.
Нуклеазалар екі түрге бөлінеді:
Экзонуклеазалар Олар ұштарынан нуклеотидтерді алып тастайды.
Эндонуклеазалар Олар ДНҚ ішіндегі белгілі бір позицияларда кесіледі.
(а) Әрбір шектеуші эндонуклеаза белгілі бір нәрсені таниды палиндромды нуклеотидтер тізбегіДНҚ-да с.
(б) Палиндрома ДНҚ-да а. оқу бағдары бірдей болған кезде екі жіпте бірдей оқылатын негізгі жұптардың тізбегі.
Мысалы, келесі реттілік 5′–> 3′ бағытында, сондай-ақ 3′–> 5′ бағыттағы екі жіпте бірдей оқылады.
5′ — GAATTC — 3′
3′ — CTTAAG — 5′
(vi) Шектеу ферменттерінің әсер ету механизмі
(а) Рестрикциялық ферменттер ДНҚ тізбегін палиндром ошақтарының ортасынан сәл алыстатады, бірақ қарама-қарсы жіптердегі бірдей екі негіз арасында.
(b) Бұл ұштарында бір жіпті бөліктерді қалдырады.
(c) Жоғарыдағы суретте көрсетілгендей әрбір жіпте жабысқақ ұштар деп аталатын асып түсетін созылулар бар. Олар осылай аталды, өйткені олар қосымша кесілген аналогтарымен сутектік байланыс түзеді.
г) Ұштарының жабысқақтығы ДНҚ лигаза ферментінің әрекетін жеңілдетеді.
(е) Рестрикциялық эндонуклеазалар гендік инженерияда әртүрлі көздерден/геномдардан алынған ДНҚ-дан тұратын ДНҚ-ның рекомбинантты молекулаларын қалыптастыру үшін қолданылады.
(f) Бұл жабысқақ ұштар бір шектеуші ферментпен кесілген кезде бір-бірін толықтырады, сондықтан ДНҚ лигазалары арқылы біріктірілуі мүмкін.

7. ДНҚ фрагменттерін бөлу және оқшаулау
(i) ДНҚ-ны шектеу эндонуклеазалары арқылы кесу нәтижесінде ДНҚ фрагменттері пайда болады.
(ii) ДНҚ фрагменттерін өлшеміне қарай бөлетін әдіс деп аталады
гельдік электрофорез.
(iii) ДНҚ фрагменттері теріс зарядталған молекулалар. Оларды орта/матрица арқылы электр өрісі астында анодқа қарай жылжытуға мәжбүрлеу арқылы бөлуге болады.
(iv) Ең көп қолданылатын орта – агароза, теңіз арамшөптерінен алынған табиғи полимер.
(v) ДНҚ фрагменттері агароздық гель қамтамасыз ететін електен өткізу әсері арқылы өлшеміне сәйкес бөлінеді (шешіледі). Фрагмент өлшемі неғұрлым аз болса, соғұрлым ол алысырақ жылжиды.
(vi) Бөлінген ДНҚ фрагменттерін ДНҚ-ны этидий бромиді деп аталатын қосылыспен бояғаннан кейін, содан кейін ультракүлгін сәулелену әсерінен кейін ғана көруге болады.
(vii) ДНҚ фрагменттерін ашық сарғыш түсті жолақтар ретінде көруге болады. Бұл бөлінген жолақтар агароздық гельден кесіліп, гель бөлігінен шығарылады. Бұл деп аталады элюция.
(viii) Тазартылған ДНҚ фрагменттерін клондау векторларымен біріктіру арқылы рекомбинантты ДНҚ құруда пайдалануға болады.

8. Векторларды клондау бөтен ДНҚ сегментін қабылдаушы жасушаға тасымалдай алатын ДНҚ молекулалары.
(i) Рекомбинантты ДНҚ технологиясында қолданылатын векторлар:
а) Плазмидалар Автономды репликацияланатын шеңберден тыс хромосомалық ДНҚ.
б) Бактериофагтар Бактерияларды жұқтыратын вирустар.
(c) Космидалар Құрамында X-ның cos сайты бар плазмидалардан алынған гибридті векторлар
(ii) Нөмірді көшіру ұяшықтағы векторлардың көшірмелерінің саны ретінде анықталуы мүмкін.
(iii) Бактериофагтар жасуша саны жоғары, сондықтан олардың көшірме саны геномында да жоғары.
(iv) Плазмидалар әр ұяшықта тек бір немесе екі көшірме болады.
(v) Көшірме саны әр ұяшыққа 1-100 немесе 100 данадан көп болуы мүмкін.
(vi) ДНҚ-ның бөгде бөлігі бактериофагпен немесе плазмидтік ДНҚ-мен байланысқан болса, оның санын плазмиданың немесе бактериофагтың көшірме санына тең көбейтуге болады.
(vii) Векторға клондауды жеңілдету үшін қажетті мүмкіндіктер
(a) Репликацияның шығу тегі (Ori) (b) Таңдалатын маркер
(c) клондау учаскелері (d) өсімдіктер мен жануарлардағы гендерді клондауға арналған векторлар.
(а) Репликацияның шығу тегі (Ori) – репликация басталатын орыннан реттілік.

  • Осы реттілікпен байланысқан кез келген ДНҚ бөлігі хост жасушаларында репликациялануы мүмкін.
  • Жүйе сонымен қатар байланыстырылған ДНҚ көшірме нөмірін басқаруға жауап береді.

(b) Таңдалатын маркер трансформацияланбайтындарды анықтауға және жоюға және трансформаторлардың өсуіне таңдаулы түрде мүмкіндік беруге көмектеседі.

  • Трансформация ДНҚ бөлігінің иесі бактерияға енгізілетін процесс.
  • Ампициллин, левомицетин, тетрациклин немесе канамицин және т.б. сияқты антибиотиктерге төзімділікті кодтайтын гендер коли үшін кейбір пайдалы таңдалатын маркерлер болып табылады.


E.coli клондау векторы pBR322 шектеу орындарын көрсетеді (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori және антибиотиктерге төзімділік гендер (amp R және tet R).
плазмиданың репликациясына қатысатын ақуыздардың роп кодтары.

  • Бөтен ДНҚ-ны байлау екі антибиотикке төзімділік гендерінің бірінде болатын шектеу орнында жүзеге асырылады. Мысалы, pBR322 векторындағы тетрациклинге төзімділік генінің Bam HI орнында бөгде ДНҚ-ны байлау.
    –>>Рекомбинантты плазмидалар бөгде ДНҚ-ның енуіне байланысты тетрациклинге төзімділігін жоғалтады. Бірақ оны ампициллин бар ортаға трансформациялауыштарды жағу арқылы рекомбинантты еместерден таңдауға болады.
    –>> Құрамында ампициллин бар ортада өсетін трансформаторлар содан кейін тетрациклин бар ортаға тасымалданады.
    –>>Рекомбинанттар ампициллині бар ортада өседі, бірақ тетрациклин бар ортада өспейді.
    –>>Рекомбинанттар антибиотиктердің екеуі де бар ортада өседі.
    Бұл мысалда бір антибиотикке төзімділік гені трансформацияларды таңдауға көмектеседі, ал басқа антибиотикке төзімділік гені бөтен ДНҚ-ның «енгізілуіне байланысты» белсенділенеді және рекомбинантты таңдауға көмектеседі.
  • Рекомбинантты таңдау антибиотиктерді инактивациялау қиын процедура болып табылады, сондықтан рекомбинантты рекомбинантты емес рекомбинантты хромогенді субстрат болған кезде түс шығару қабілеті негізінде ажырататын балама таңдалатын маркерлер әзірленді.

–>> Бұл әдісте рекомбинантты ДНҚ J3-галактозидаза ферментінің кодтау тізбегіне енгізіледі.
–>> Бұл P-галактозидаза ферментінің инактивациясына әкеледі (инсерциялық инактивация).
–>> Плазмидаларында кірістіруі жоқ бактерия колониялары көк түс береді, ал басқалары хромогенді субстратта өсіргенде ешқандай түс бермейді.
(c) сайттарды клондау бөтен ДНҚ-ны вектормен байланыстыру үшін қажет.

  • Вектор жиі қолданылатын шектеу ферменттері үшін өте аз немесе жалғыз тану орындарын қажет етеді.
  • Векторда бірнеше тану учаскелерінің болуы генді клондау кезінде асқынуға әкелетін бірнеше фрагменттерді тудырады.

(d) өсімдіктер мен жануарлардағы гендерді клондауға арналған векторлар өсімдіктер мен жануарлардың гендерін клондау үшін қолданылатын көптеген заттар.
Өсімдіктерде Agrobacterium tumefaciens ісік қоздырғыш (Ti) плазмиді клондау векторы ретінде пайдаланылады.
–>>Agrobacterium tumefaciens – бірнеше қос жарнақты өсімдіктердің қоздырғышы.
–>> Ол патогендерге қажетті химиялық заттарды өндіру үшін қалыпты өсімдік жасушаларын ісік жасушаларына айналдыратын Ti плазмидасындағы Т-ДНҚ деп аталатын ДНҚ бөлігін жеткізеді. Ретровирус, аденовирус, папилломавирус енді жануарларда трансформациялау қабілетіне байланысты клондау векторлары ретінде пайдаланылады. қалыпты жасушаларды рак клеткаларына айналдырады.

9. Құзыретті иесі ағза (рекомбинантты ДНҚ-мен трансформациялау үшін) қажет, өйткені ДНҚ гидрофильді молекула болғандықтан жасуша мембраналарынан өте алмайды,
Демек, бактериялар ДНҚ молекулаларын қабылдауға қабілетті болуы керек,
(i) Құзыреттілік жасушаның бөгде ДНҚ-ны қабылдау қабілеті.
(ii) ұяшықты сауатты ету әдістері төмендегідей.
а) Химиялық әдіс Бұл әдісте жасуша қабырғасындағы кеуектер көлемін ұлғайту үшін жасуша кальций сияқты екі валентті катионның белгілі бір концентрациясымен өңделеді.
Содан кейін жасушалар мұзда рекомбинантты ДНҚ-мен инкубацияланады, содан кейін орналастырылады
оларды 42°C температурада қысқа мерзімге, содан кейін мұзға қайта салыңыз. Бұл термиялық соққымен өңдеу деп аталады. Бұл бактериялардың рекомбинантты ДНҚ қабылдауына мүмкіндік береді.
(b) Физикалық әдістер Бұл әдісте рекомбинантты ДНҚ микроинъекция әдісімен жануар жасушасының ядросына тікелей енгізіледі.
Өсімдіктерде жасушалар алтынның жоғары жылдамдықтағы микробөлшектерімен бомбаланады немесе
ДНҚ-мен қапталған вольфрам биолистикалық немесе гендік қару әдісі деп аталады.
(c) Қарусыздандырылған патогенді тасымалдаушылар жасушаны жұқтыруға рұқсат етілгенде, рекомбинантты ДНҚ-ны иесіне тасымалдаңыз.

Өткен жылдардағы емтихан сұрақтары

1 Сұрақтарды белгілеңіз
1. Неліктен бөгде ДНҚ хромосоманың ұзындығы бойынша кез келген жерінде бір бөлігіне айналуы және қалыпты репликациялануы мүмкін емес?
[Барлық Үндістан 2014]
Ans.Хромосоманың бөлігі болу үшін бөтен ДНҚ-ның интеграциясы қажет. Өйткені ДНҚ өзі көбейіп, репликациялана алмайды, керісінше оның репликациясын бастау үшін репликацияның бастауы деп аталатын белгілі бір реттілік қажет. Сондықтан, бөтен ДНҚ хромосоманың бір бөлігі болуы және оның көшірмелерін жасау үшін қалыпты түрде репликациялануы үшін ферменттердің көмегімен иесі ДНҚ-ға қосылуы және Оримен байланысуы керек.

2. Бөтен ДНҚ-ны енгізу үшін гендік қару үшін қолайлы хост жасушаларының түрін атаңыз. [Дели 2014]
Ans. Бөтен ДНҚ-ны енгізу үшін гендік қаруларға қолайлы хост жасушалары өсімдік жасушалары болып табылады.

3. Коэн мен Бойер құрастырған алғашқы жасанды рекомбинантты ДНҚ молекуласының екі компонентін жазыңыз. [Шетелдік 2014]
Ans.Гоэн мен Бойер құрастырған алғашқы жасанды рекомбинантты ДНҚ молекуласының екі компоненті:
(i) антибиотиктерге төзімділік гені
(ii) Salmonella typhimurium плазмиді

4. Бөтен ДНҚ енгізу үшін микроинъекция әдісі қолданылатын хост жасушаларын атаңыз. [Шетелдік 2014]
Ans. Бөтен ДНҚ-ны енгізуге арналған микроинъекция әдісі әдетте жануарлардың жасушасында, яғни тікелей ядрода жүзеге асырылады.

5. Гельдік электрофорезде матрица ретінде қолданылатын материалды атаңыз және оның рөлін атаңыз. [Барлық Үндістан 2014C]
Ans. Гель электрофорезінде матрица ретінде қолданылатын материал - агароза.
Бұл агароздық гель ДНҚ фрагменттерін мөлшеріне сәйкес бөлу үшін елеуіш ретінде әрекет етеді.

6. Рекомбинанттық технология тәжірибелерінде қажетті ДНҚ сегментін бактериялық жасушаға енгізудің кез келген төрт әдісін жазыңыз. [Барлық Үндістан 2013]
Ans. Қажетті ДНҚ-ны бактерия жасушасына енгізу жолдары:
(i) микроинъекция (ii) қарусыздандырылған патогенді тасымалдаушылар
(iii) кальций сияқты екі валентті катион бойынша бөлік
(iv) бидлистикалық немесе гендік қару

7. pBR322 плазмидасының Sal I орнында бөгде ген байланыстырылғанда не болатынын көрсетіңіз. [Дели 2013c]
Ans. Егер бөтен ген pBR322 векторындағы тетрациклинге төзімділік генінің Sal I орнында байланған болса, рекомбинантты плазмида тетрациклинге төзімділігін жоғалтады.

8. Биотехнологияда клондау векторының қолданылуын атаңыз? [Дели 2011]
Ans. Биотехнологияда клондау векторының қолданылуы.
(i) Бөтен/бөтен ДНҚ-ны иесінің ДНҚ-сымен байланыстыруға көмектеседі.
(ii) Рекомбинантты еместерден erf рекомбинантты таңдауға көмек.

9. Биотехнологтар Agrobacterium tumefaciens-ті өсімдіктердің табиғи гендік инженері деп атайды. Мәлімдемені қолдауға дәлел келтіріңіз.
[ HOTS All India 2011]
Ans. Agrobacterium tumefacieps – бірнеше қос жарнақты өсімдіктердің қоздырғышы. Ол табиғи гендік инженер ретінде пайдаланылады, өйткені ол қалыпты өсімдік жасушаларын ісік жасушаларына айналдыру және ісік жасушаларын патогенге қажетті химиялық заттарды синтездеуге бағыттау үшін ДНҚ-ның бір бөлігін (Т-ДНҚ деп аталады) жеткізе алады.

10. Неліктен клондау векторында таңдалатын маркердің болуы маңызды? [Барлық Үндістан 2011]
Ans.Клондау векторындағы таңдалатын маркер рекомбинантты анықтауға және таңдауға және рекомбинантты еместерді жоюға көмектеседі.

11. Неліктен гельдік электрофорез кезінде ДНҚ фрагменттері анодқа қарай жылжиды? [Ыстық Дели 2011c]
Ans. ДНҚ фрагменттері теріс зарядталған молекулалар болып табылады, сондықтан гельдік электрофорез кезінде анодқа қарай жылжиды.

12. 1963 жылы ішек таяқшасында бактериофагтың өсуін шектеуге жауапты екі фермент бөлініп алынды. Бактериофагтардың өсуін шектеу үшін ферменттер қалай әрекет етті? [Барлық Үндістан 2011c]
Ans.Колидегі бактериофагтардың өсуін шектеуге жауапты екі фермент: экзонуклеазалар ДНҚ-ға метил тобын қосады. Эндонуклеазалар ДНҚ-ны белгілі бір нүктелерде кеседі.

13. Экзонуклеазаның әрекеті эндонуклеаза әсерінен несімен ерекшеленеді.
[Барлық Үндістан 2010]
Ans.Экзонуклеаза ДНҚ ұштарынан нуклеотидтерді жояды, ал эндонуклеаза ДНҚ-ны белгілі бір позицияларда кеседі.

14. Рекомбинантты ДНҚ технологиясындағы молекулалық қайшының рөлін атаңыз. [Барлық Үндістан 2009]
Ans. Молекулярлық қайшылар немесе шектеу ферменттері ДНҚ-ны белгілі бір жерде кесіп тастайды, осылайша қажетті генді бөліп алуға және оны иесінің ДНҚ-сымен ұнатуға мүмкіндік береді.

15. Зертханада ДНҚ фрагменттерін бөлу үшін қолданылатын әдісті атаңыз. [Дели 2008]
Ans. Гель электрофорезі зертханада ДНҚ фрагменттерін бөлу үшін қолданылады.

16. ДНҚ фрагменттерінің агарозды гельді электрофорезі кезінде этидий бромидінің рөлі қандай? [Барлық Үндістан 2008C]
Ans. Агарозды гель электрофорезі кезінде бөлінген ДНҚ фрагменттері ДНҚ-ны этидий бромидімен бояғаннан кейін УК сәулесінде көрінеді. Бұл бояу ДНҚ-ға ашық сарғыш түс береді.
2 Бағалау сұрақтары
17. Рестрикциялық нуклеаза қалай қызмет етеді? Түсіндіріңіз. [Барлық Үндістан 2014]
Ans. Шектеу нуклеазалары ДНҚ тізбегінің ұзындығын тексеру, содан кейін белгілі бір тану ретімен байланыстыру және қант фосфатының магистральдарындағы жіптерді кесу арқылы жұмыс істейді.
Бұл нуклеазалар әрекет ету тәсіліне қарай екі түрге бөлінеді.
(i) Рестрикциялық экзонуклеазалар ДНҚ-ның соңғы ұштарында кесілген тізбектер.
(іі) Рестрикциялық эндонуклеазалар тану тізбегінің екі негізін кесіңіз.

18.pBR322 клондау векторындағы Ori және шектеу орнының рөлін жазыңыз.
[Дели 2014]
немесе
Ori және клондау сайттары векторға клондауды қалай жеңілдетеді?
[Барлық Үндістан 2008C]
Ans.Ори - репликация басталатын ДНҚ тізбегі. Хост жасушасында репликациялануы қажет кез келген ДНҚ бөлігі онымен байланыстырылуы керек.
Тораптарды клондау бөтен ДНҚ байланыстырылған ДНҚ сайтына/тізбегіне жатады.

19. Рестрикциялық эндонуклеазаның атын лайықты мысал арқылы түсіндіріңіз. [Дели 2014]
Ans. Рестрикциялық эндонуклеазалардың атауы:
(i) Атаудың бірінші әрпі тектен, ал келесі екі әріп ферменттер алынатын прокариоттық жасуша түрінен келеді.
(ii) Атаудан кейінгі римдік сандар ферменттердің бактерия штаммынан бөлінген ретін көрсетеді. Мысалы, Eco Rl ішек таяқшасынан RY 13, Hind II Haemophilus influenzae Rd және т.б.

20. ДНҚ тізбегінде жабысқақ ұштар қалай түзіледі? Неліктен олар осылай аталады? [Дели 2014]
Ans.ДНҚ-дағы жабысқақ ұштар рестрикциялық эндонуклеаза ферменттерінің әсерінен түзіледі. Бұл ферменттер ДНҚ тізбегін екі жіптегі бірдей екі негіз арасында палиндром тізбегінің ортасынан сәл алыстатады. Бұл олардың ұштарындағы қосымша жіптердің екеуінде де бір жіпті созылуларға әкеледі.
Бұл асып түсетін созылулар жабысқақ ұштар деп аталады, өйткені олар қосымша негіз жұбының тізбектерімен сутегі байланыстарын құрайды.

21. Рекомбинантты рекомбинантты еместерден ажырату үшін таңдалатын маркер ретінде ферментті инсерциялық инактивациялау қалай қолданылады?
[Шетелдік 2014]
Ans. J3-галактозидаза ферментінің инсерциялық активтенуі, яғни ферменттің кодтау аймағына қажетті генді енгізу арқылы, (рекомбинанттардағы 3-галактозидаза генінің) инактивациясына әкеледі. Трансформацияланған қожайындардағы рекомбинантты хромогенді субстратта өсіргенде ешқандай түс бере алмайды. , осылайша рекомбинантты рекомбинантты еместерден ажырату үшін таңдалатын маркер ретінде әрекет етеді.

22. Тиісті мысалдың көмегімен палиндромдық нуклеотидтер тізбегін түсіндіріңіз. [Шетелдік 2014]
Ans.Палиндромды нуклеотидтер тізбегі – ДНҚ-ның екі комплементарлы тізбегінде де бірдей оқылатын, оқудың бірдей бағдары бар ДНҚ-дағы негіз жұптарының тізбегі.
Мысалға
5′-GAATTC-3′
3′-CTTAAG-5′

23. Молекулярлық қайшылар неліктен осылай аталады? Олардың биотехнологияда қолданылуын жаз? [Шетелдік 2014]
Ans. Молекулалық қайшылар ДНҚ-ны негіз жұптары арасындағы белгілі бір реттілікпен кесетіндіктен осылай аталады.
Рестриктеуші ферменттердегі молекулалық қайшылар ДНҚ-ны қажетті реттілікпен кесіп, иесі геномымен немесе векторлық ДНҚ-мен қосылуды жеңілдететін жабысқақ ұштарды жасайтындықтан, олар гендік инженерияда немесе биотехнологияда маңызды рөл атқарады. Өйткені, осы ферменттердің көмегімен біз қажетті генді кесіп, экспрессия үшін векторларға енгізе аламыз.

24. Неліктен биотехнологиялық эксперименттер үшін жасушаларды сауатты ету қажет? Бұған қол жеткізудің кез келген екі жолын көрсетіңіз.
[Дели 2014C]
Ans. ДНҚ молекулалары гидрофильді болғандықтан, олар жасуша мембранасынан өте алмайды. Рекомбинантты ДНҚ векторға немесе қожайын геномына интеграциялануы үшін ДНҚ жасушаға енгізілуі қажет. Сондықтан биотехнологиялық эксперименттерде қабылдаушы жасушаларды сауатты ету қажет.
Жасушаларды ДНҚ қабылдауға қабілетті етудің екі жолы бар:
(i) Химиялық әрекет Екі валентті катионның, кальцийдің концентрациясын жоғарылатып, сол арқылы жасушадағы, қабырғадағы тесіктер арқылы енетін ДНҚ тиімділігін арттырады.
(ii) Жылу соққысымен өңдеу Жасушаларды рекомбинантты ДНҚ-сы бар мұзда инкубациялау, содан кейін 42 °C температурада қысқа мерзімді өңдеу және қайтадан мұзға қою.

25. Экзонуклеазаның эндонуклеазадан функционалдық айырмашылығы неде? Сал I-ден басқа кез келген екі эндонуклеазаға мысал келтіріңіз. [Дели 2013C]
Ans. Экзонуклеазалар - бұл ДНҚ-ның негізгі жұптарын соңғы ұштарында бөлетін және ДНҚ-ның бір тізбегіне немесе қос тізбекті ДНҚ-дағы бос орындарға әсер ететін ферменттер. Ал, эндонуклеазалар ДНҚ-ны терминал ұштарынан басқа кез келген нүктеде ыдыратады және қос тізбекті ДНҚ-ның бір жіпшесінде немесе екі тізбегінде кесу жасай алады, мысалы. Eco Rl және Hind II.

26. Биотехнологияға орасан зор үлес қосқан Коэн мен Бойер жүргізген жұмыстарды түсіндіріңіз. [Дели 2012]
Ans. (i) Стэнли Коэн мен Герберт Бойер алғашқы жасанды рекомбинантты ДНҚ (рДНҚ) молекуласын құрастырды.
(ii) Олар рестриктазаның көмегімен плазмидадан ДНҚ бөлігін кесіп алу арқылы антибиотикке төзімділік генін бөліп алды және оны DNAIigase көмегімен Salmonella typhimurium нативті плазмидасымен байланыстырды.

27. (i) а-галактозидаза ферментінің геніне енгізілген қызығушылық гені бар рекомбинантты вектор бактерияға енгізіледі. Рекомбинантты емес колониялардан рекомбинантты колонияларды таңдауға көмектесетін әдісті түсіндіріңіз.
(ii) Неліктен бұл әдіс? (.инсерциялық инактивация деп аталатын таңдаудың? [HOTS All India 2012]
Ans. (i) рекомбинантты колонияларды рекомбинантты емес колониялардан хромогендік субстрат болған кезде түс бере алмауымен ажыратуға болады.
Рекомбинанттар ешқандай түс шығармайды, ал рекомбинанттар ортада хромогенді субстратпен көк түс береді.
(ii) а-галактозидаза ферменті ферменттің кодтау тізбегі шегінде рекомбинантты ДНҚ енгізілгенде инактивацияланады. Осылайша, әдіс кірістіру инактивациясы деп аталады.

28. Неліктен ДНҚ-ның бөгде бөлігін клондау үшін иесі ДНҚ-ның белгілі бір тізбегіне біріктіру қажеттігін түсіндіріңіз?
[Барлық Үндістан 2011]
Ans.ДНҚ репликациясы репликацияның шығу тегі деп аталатын арнайы ДНҚ тізбегінен басталады. Хосттағы бөтен ДНҚ-ны көбейту үшін оны репликацияның шығу тегіне (ори) біріктіру керек.

29. Рекомбинантты ДНҚ технологиясында қолданылатын негізгі құралдарды атаңыз. [Дели 2011]
Ans.Рекомбинантты технологияда қолданылатын негізгі құралдар – шектеу ферменттері, полимеразалар, лигазалар, клондау векторлары. және құзыретті иесі ағза немесе жасушалар.

30. Ти плазмидаларының биотехнологиядағы рөлін түсіндіріңіз. [Дели 2011]
Ans.Agrobacterium-ның Ti плазмиді өсімдік жасушаларының ісікке табиғи түрленуіне жауап береді. Осылайша, ол патогенді емес ic векторына өзгертілген, бірақ ДНҚ-ны жеткізе алады. Бұл Agrobacterium қарусыздандырылған плазмид өсімдік жасушаларының трансформациясы үшін вектор ретінде пайдаланылады, осылайша биотехнологияда маңызды рөл атқаратыны дәлелденді.

31. Рекомбинантты векторлар қалай құрылады? Неліктен бір рекомбинантты векторды құру үшін шектеуші эндонуклеазаның бір ғана түрі қажет? [Шетелдік 2011]
Ans.Рекомбинантты векторларды құру Векторлық ДНҚ белгілі бір шектеу орнында қажетті ДНҚ сегментін кесу үшін пайдаланылған рестрикция ферментімен кесіледі. Бөтен ДНҚ содан кейін рекомбинантты векторды құру үшін лигаза ферментінің көмегімен векторлық ДНҚ-мен байланысады.
Өйткені, шектеу ферменті ДНҚ-ны белгілі бір ретпен таниды және кеседі
тану учаскесі деп аталады, бірдей шектеу ферменті ДНҚ сегментін вектордан да, басқа көзден де кесу үшін пайдаланылады, sp, олардың қосылуын жеңілдету үшін екі ДНҚ молекуласында бірдей жабысқақ ұштарды шығарады.

32. Төменде берілген сызбаны зерттеп, келесі сұрақтарға жауап беріңіз
(i) Неліктен D банкасындағы ДНҚ фрагменттері С жолағындағылармен салыстырғанда алысырақ жылжыды?
(ii) Анодтың ұшын диаграммада анықтаңыз.
(iii) Бұл ДНҚ фрагменттері қалай бейнеленген? [Шетелдік 2011]
Ans. (i) D жолағында ДНҚ фрагменттері С жолағындағыдан кішірек. Фрагменттер гель беретін елеу әсері арқылы өлшемдеріне қарай бөлінеді Осылайша, кіші фрагменттер үлкеніректерге қарағанда алысырақ жылжиды.
(ii) B - диаграммадағы анодтың ұшы.
(iii) ДНҚ фрагменттері бар гель этидиум бромидімен боялады және ультракүлгін сәулеленуге ұшырайды. ДНҚ-ның сарғыш түсті жолақтары көрінеді.

33. Вектор ДНҚ мен бөгде ДНҚ-ның жабысқақ ұштары қосылғанда рекомбинантты ДНҚ түзіледі. Жабысқақ ұштары қалай түзіліп , қосылатынын түсіндір ? [Барлық Үндістан 2010]
Ans.Жабысқақ ұштар рестриктеуші фермент ДНҚ жіптерін палиндромдық тізбектің ортасынан аздап қиып алған кезде пайда болады.
Жабысқақ ұштары екі полинуклеотидті жіп негіздерінің комплементарлы факторы арқылы және ДНҚ лигаза ферментінің әсерінен қосылады.

34. Eco RI рестрикциялық эндонуклеазаның әрекетін түсіндіріңіз.
[Шетелдік 2010]
Ans.Рестрикциялық эндонуклеаза Eco Rl ДНҚ жіптерін палиндромдық тізбектің ортасынан сәл алыстатады, бірақ екі жіптегі бірдей екі негіз арасында, яғни G және A.
5′-GAATTC-3′
3′- C T T A A G- 5′
(i) Осыған байланысты бір жіпті бөліктер жабысқақ ұштар деп аталады, әр жіптің соңында асып түседі.
(ii) Жабысқақ болғандықтан, олар қосымша аналогтарымен оңай сутегі байланыстарын түзеді.

35. Гель электрофорезі арқылы бөлінген ДНҚ фрагменттері рекомбинантты ДНҚ құруда пайдалану үшін қалай бейнеленеді және бөлінеді?
[ Шетел 201 Бүкіл Үндістан 2008]
Ans. Бөлінген ДНҚ фрагменттері этидий бромидімен боялады.
(i) Ультракүлгін сәулеленудің әсерінен бөлінген ДНҚ фрагменттері сарғыш түсті жолақтар түрінде көрінеді.
(ii) ДНҚ-ның бөлінген жолақтары агарозды гельден кесіледі және осы гель бөліктерінен ДНҚ алынады, бұл процесс элюция деп аталады.

36. (i) Eco RI тану ретін суреттеңіз және мұндай реттіліктердің қалай аталатынын атап өтіңіз?
(ii) Рестриктазалық эндонуклеаза ДНҚ молекуласына қалай әсер етеді?
[Барлық Үндістан 2010 C]
Ans.(/’) Eco Rl тану реті
5′- G A A T T C -3′
3′- C T T A A G -3′
Бұл тізбектер палиндромдық нуклеотидтік тізбектер деп аталады.
(ii) Рестрикциялық эндонуклеаза ДНҚ-ның белгілі бір ұзындығына әсер етеді және белгілі бір тану ретімен ДНҚ-мен байланысады. Ол ДНҚ-ның қос тізбегінің екеуін де, қант фосфатының омыртқаларында, белгілі бір реттілік немесе нүктелер арасындағы палиндромдық учаскелердің орталығынан сәл алыс жерде кеседі.

37. Ti плазмидасы бөлініп алынған бастапқы организмді атаңыз. Осы плазмидтің биотехнологияда қолданылуын түсіндіріңіз. [Шетелдік 2009]
Ans. Ti плазмиді Agrobacterium tumefaciens бактерияларынан бөлініп алынған.
Agrobacterium-ның Ti плазмиді өсімдік жасушаларының ісікке табиғи түрленуіне жауап береді. Осылайша, ол патогенді емес ic векторына өзгертілген, бірақ ДНҚ-ны жеткізе алады. Бұл Agrobacterium қарусыздандырылған плазмид өсімдік жасушаларының трансформациясы үшін вектор ретінде пайдаланылады, осылайша биотехнологияда маңызды рөл атқаратыны дәлелденді.

38. Агарозаның табиғи көзін атаңыз. Биотехнологиядағы агарозаның бір рөлін атап өтіңіз. [Дели 2009c]
Ans.Агарозаның табиғи көзі теңіз арамшөптері болып табылады. Агарозаның биотехнологиядағы рөлі
(i) Ол гельдік электрофорез үшін матрицаны әзірлеу үшін қолданылады.
(ii) Бұл фрагменттерді өлшеміне қарай бөлуге көмектеседі.

39. Төменде көрсетілген ДНҚ фрагменттерінің байланысын зерттеңіз:

E.coli клондау векторы pBR322 шектеу орындарын көрсетеді (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori және антибиотиктерге төзімділік гендер (amp R және tet R).
плазмиданың репликациясына қатысатын ақуыздардың роп кодтары.

  • А ДНҚ және В ДНҚ атаңыз.
  • Осы палиндромды танитын рестриктазаны атаңыз.

Осы екі ДНҚ фрагменттерін байланыстыра алатын ферментті атаңыз.
[Дели 2008]
Ans. (i) – векторлық/плазмидтік ДНҚ
B – Шетелдік ДНҚ
(ii) Eco Rl
(iii) ДНҚ лигазасы40. Төменде ДНҚ фрагменттерінің байланысы көрсетілген.

(i) А және В атаулары.
(ii) Eco RI таныған палиндромды толтырыңыз.
(iii) Екі ДНҚ фрагменттерін байланыстыра алатын ферментті атаңыз.
[Шетелдік 2008]
Ans.(i) A – векторлық ДНҚ, B-шетелдік ДНҚ
(ii) 5′- GAATTC-3′
3′- CTTAAG-5′
(iii) ДНҚ лигазасы
3 Бағалау сұрақтары

41. Рестрикциялық эндонуклеазаны қолдану арқылы түзілген ДНҚ фрагменттерін бөлуге көмектесетін әдісті атаңыз және сипаттаңыз. [Барлық Үндістан 2014]
Ans. Рестрикциялық эндонуклеазаларды қолдану арқылы түзілген ДНҚ фрагменттері гельдік электрофорез арқылы бөлінеді.
(i) ДНҚ фрагменттері теріс зарядталған молекулалар. Осылайша, олар орта арқылы электр өрісі астында анодқа қарай жылжиды.
(ii) ДНҚ фрагменттері агароздық гельдің севитивтік әсерінен олардың өлшеміне қарай бөлінеді.
(iii) Бөлінген ДНҚ фрагменттерін ДНҚ-ны этидий бромидімен бояу, содан кейін ультракүлгін сәулеленуге ұшырау арқылы көруге болады.
(iv) ДНҚ-ның бөлінген жолақтары кесіліп, гель бөлігінен алынады. Бұл элюция ретінде белгілі.

42. pBR322 коликлондау векторының принципиалды сызбасын сызыңыз және оған мынаны белгілеңіз.

  • ори
  • роп
  • ампициллинге төзімділік гені
  • тетрациклинге төзімділік гені
  • шектеу сайты Bam HI
  • шектеу сайты EcoRI

(i) Eco таныған нуклеотидтер тізбегі бар вектор мен бөгде ДНҚ сегменттерінің принципиалды диаграммаларын салыңыз.
(ii) EcoRI әрекетінен кейін құрғақ бөгде ДНҚ сегменттерінің векторлық ДНҚ сегментін сызыңыз және алынған жабысқақ ұштарды белгілеңіз. [Дели 2014C]
немесе
pBR322 плазмидасының схемалық сызбасын сызыңыз және оған төмендегілерді белгілеңіз

  • Кез келген екі шектеу сайты.
  • Ори және роп
  • Антибиотиктерге төзімді ген. [Дели 2012].

Ans. coli клондау векторы pBR322.
E.coli клондау векторы pBR322 шектеу орындарын көрсетеді (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori және антибиотиктерге төзімділік гендер (amp R және tet R).
плазмиданың репликациясына қатысатын ақуыздардың роп кодтары.
немесе
(а) Рестрикциялық ферменттер ДНҚ тізбегін палиндром ошақтарының ортасынан сәл алыстатады, бірақ қарама-қарсы жіптердегі бірдей екі негіз арасында.
(b) Бұл ұштарында бір жіпті бөліктерді қалдырады.
(c) Жоғарыдағы суретте көрсетілгендей әрбір жіпте жабысқақ ұштар деп аталатын асып түсетін созылулар бар. Олар осылай аталды, өйткені олар қосымша кесілген аналогтарымен сутектік байланыс түзеді.
г) Ұштарының жабысқақтығы ДНҚ лигаза ферментінің әрекетін жеңілдетеді.
(е) Рестрикциялық эндонуклеазалар гендік инженерияда әртүрлі көздерден/геномдардан алынған ДНҚ-дан тұратын ДНҚ-ның рекомбинантты молекулаларын қалыптастыру үшін қолданылады.
(f) Бұл жабысқақ ұштар бір шектеуші ферментпен кесілген кезде бір-бірін толықтырады, сондықтан ДНҚ лигазалары арқылы біріктірілуі мүмкін.43. Клондау векторындағы ‘сайттарды клондау’? Олардың рөлін түсіндіріңіз. pBR322-де осындай екі сайтты атаңыз. [Барлық Үндістан 2014C]
Ans.Клондау сайттары іс жүзінде рекомбинантты ДНҚ молекулаларын жасау үшін бөтен ДНҚ-ны векторлық ДНҚ-мен байланыстыру үшін белгілі бір рестриктаза ферментінің ерекше бірегей тану тізбегі болып табылады, (l) Бұл сайттар вектор мен бөтен ДНҚ фрагменттерін біріктіру үшін маңызды. ДНҚ. Сондай-ақ ДНҚ немесе вектор ішіндегі белгілі бір шектеу ферментін бірнеше рет тану тізбегі генді клондау процесін қиындатады.
pBR322-дегі екі клондау орны тетрациклинге төзімді геннің Bam HI және ampiciMies төзімді гендерінің Pvu I болып табылады.

44. ДНҚ-ның саусақ ізін алу үшін ДНҚ фрагменттері қалай бөлінеді және оқшауланады? Түсіндіріңіз. [Шетелдік 2012]
Ans. Рестрикциялық эндонуклеазаларды қолдану нәтижесінде түзілген ДНҚ фрагменттері гельдік электрофорез арқылы бөлінеді.
(i) ДНҚ фрагменттері теріс зарядты молекулалар. Осылайша, олар орта арқылы электр өрісі астында анодқа қарай жылжиды.
(ii) ДНҚ фрагменттері агароздық гельдің севитивтік әсерінен олардың өлшеміне қарай бөлінеді.
(iii) Бөлінген ДНҚ фрагменттерін ДНҚ-ны этидий бромидімен бояу, содан кейін ультракүлгін сәулелену арқылы көруге болады.
(iv) ДНҚ-ның бөлінген жолақтары кесіліп, гель бөлігінен алынады. Бұл элюция ретінде белгілі

45. (i) Неліктен рестрикциялық эндонуклеазалар осылай аталады?
(ii) Палиндромды, нуклеотидтік тізбек дегеніміз не? Рестрикциялық эндонуклеазалар жабысқақ ұштарды жасау үшін палиндромдық учаскелерде қалай әрекет етеді?
[Дели 2011C]
Ans. (i) Рестрикциялық эндонуклеазалар осылай аталады, өйткені олар ДНҚ ішіндегі белгілі бір позицияларды танып, кесіп тастайды және бактериофагтардың өсуін шектейді.
(ii) (а) ДНҚ-дағы палиндром – оқу бағыты бірдей болған кезде ДНҚ-ның екі тізбегінде бірдей оқылатын негіз жұптарының тізбегі.
Мысалға,
5’—GAATTG—3′
3’—CTTAAG—5′
(b) Рестрикциялық ферменттер ДНҚ тізбегін палиндром аймағының ортасынан сәл алыстатады, бірақ екі жіптегі бірдей екі негіз арасында. Бұл палиндромның ұштарында жабысқақ ұштар деп аталатын бір жіпті созылуларды жасайды.

46. ​​Төмендегілер биотехнологияда қалай қолданылады?

  • Плазмидті ДНҚ
  • Тану реті
  • Гель электрофорезі [Барлық Үндістан 2011c]

Ans. (i) Плазмидтік ДНҚ Ол ДНҚ-ның бөгде бөлігін онымен байланыстыру арқылы рекомбинантты ДНҚ құру үшін қолданылады. Ол клондау векторы ретінде пайдаланылады және рекомбинантты емес рекомбинантты таңдауға көмектеседі.

(ii) тану реті Бұл рестрикциялық фермент ДНҚ-ны кесетін ДНҚ-ның арнайы базалық тізбектері. Олар ДНҚ молекулаларынан қажетті генді немесе фрагменттерді алу үшін қолданылады.
(iii) Гель электрофорезі Бұл гельдің севиверлік әсері арқылы ДНҚ фрагменттерін мөлшеріне қарай бөлу үшін қолданылатын әдіс.47. EcoRI бөгде ДНҚ сегментін және рекомбинантты ДНҚ түзу үшін векторлық ДНҚ сегментін кесу үшін қолданылады. Схема-сызбалар арқылы көрсету.

  • Негіз жұптарының палиндромды нуклеотидтер тізбегінің жиынтығы EcoRI екі ДНҚ сегментінде де таниды. EcoRI әрекет ететін сайтты белгілеп, екі сегментті де кесіңіз.
  • Екі сегментте де жабысқақ ұштар пайда болды, онда екі ДНҚ сегменті кейінірек рекомбинантты ДНҚ түзу үшін қосылады. [Дели 2010]

Ans. Eco Rl палиндромдық тізбегі болып табылады

5′ G AATTC 3′
3’C TTAA G 5′ т
(көрсеткілер жіптерді кесетін орынды көрсетеді.)
(ii) Екі сегментте де қалыптасқан жабысқақ ұштар.
(а) Рестрикциялық ферменттер ДНҚ тізбегін палиндром ошақтарының ортасынан сәл алыстатады, бірақ қарама-қарсы жіптердегі бірдей екі негіз арасында.
(b) Бұл ұштарында бір жіпті бөліктерді қалдырады.
(c) Жоғарыдағы суретте көрсетілгендей әрбір жіпте жабысқақ ұштар деп аталатын асып түсетін созылулар бар. Олар осылай аталды, өйткені олар қосымша кесілген аналогтарымен сутектік байланыс түзеді.
г) Ұштарының жабысқақтығы ДНҚ лигаза ферментінің әрекетін жеңілдетеді.
(е) Рестрикциялық эндонуклеазалар гендік инженерияда әртүрлі көздерден/геномдардан алынған ДНҚ-дан тұратын ДНҚ-ның рекомбинантты молекулаларын қалыптастыру үшін қолданылады.
(f) Бұл жабысқақ ұштар бір шектеуші ферментпен кесілген кезде бір-бірін толықтырады, сондықтан ДНҚ лигазалары арқылы біріктірілуі мүмкін.48. (i) Қажетті геннің көшірмелерін алу үшін көрсетілген вектор енгізілген ағзаны атаңыз.

  • Енгізілген геннің көшірме нөмірін басқаруға жауапты векторда белгіленген аумақты атап өтіңіз.
  • А-ның рөлін атаңыз және түсіндіріңізвектордағы таңдалатын маркер Көрсетілген. [Барлық Үндістан 2010]

Ans. (i) ішек таяқшасы (E. coli)
(ii) вектордағы Ori енгізілген геннің көшірме санын бақылауға жауапты.
(iii) Таңдалатын маркерлер ретінде тетрациклинге төзімді tet R, ампициллинге төзімді амп R сияқты антибиотиктерге төзімділікті кодтайтын гендер пайдаланылады. Тетрациклинге төзімділік генінің Bam HI орнында бөгде ДНҚ байланса, рекомбинантты плазмидтер тетрациклинге төзімділігін жоғалтады.
Таңдалатын маркерлер трансформацияланбайтындарды анықтауға және жоюға көмектеседі және трансформаторлардың өсуіне таңдаулы түрде мүмкіндік береді.

49. (i) EcoRI – шектеуші эндонуклеаза. Бұл қалай аталады? Түсіндіріңіз.
(ii) Фермент танитын ДНҚ негіздерінің тізбегін жазыңыз. Фермент ДНҚ сегментінде кесінді жасайтын нүктені атаңыз. [Дели 2010c]
Ans.(I) Рестрикциялық эндонуклеазаның атауы:
(i) Атаудың бірінші әрпі тектен, ал келесі екі әріп ферменттер алынатын прокариоттық жасуша түрінен келеді.
(ii) Атаудан кейінгі римдік сандар ферменттердің бактерия штаммынан бөлінген ретін көрсетеді. Мысалы, Eco Rl ішек таяқшасынан RY 13, Hind II Haemophilus influenzae Rd және т.б.
(II) тану тізбегі палиндром болып табылады, мұнда базалық жұптың тізбегі ДНҚ тізбегінің екеуінде де бірдей оқылады, оқу бағыты бірдей болған кезде,
мысалы, 5′- GAATTC -3′
3′- CTTAAG -5′
Eco Rl ферменті GAATTC тізбегі болғанда ғана екі жіптегі G және A негіздеріндегі ДНҚ сегментін кеседі.

50. (i) ДНҚ фрагменттерін бөлу үшін қолданылатын әдісті атаңыз.

  • Осы техникада қолданылатын матрицаның түрін жазыңыз.
  • Бөлінген ДНҚ рекомбинантты технологияда пайдалану үшін қалай визуалды және экстракцияланады? [Барлық Үндістан 2010]

Ans. (i) Гель электрофорезі.

(ii) Гель электрофорезінде матрица ретінде пайдаланылатын материал агароза болып табылады.
Бұл агароздық гель ДНҚ фрагменттерін мөлшеріне сәйкес бөлу үшін елеуіш ретінде әрекет етеді.
(iii) Бөлінген ДНҚ фрагменттері этидий бромидімен боялады.
(a) Ультракүлгін сәулеленудің әсерінен бөлінген ДНҚ фрагменттері сарғыш түсті жолақтар түрінде көрінеді.
(b) ДНҚ-ның бөлінген жолақтары агароздық гельден кесіліп алынады және осы гель бөліктерінен ДНҚ алынады, бұл процесс элюция деп аталады.

51. (i) Төменде көрсетілген E. coli векторының диаграммасында таңдалатын нарықтарды анықтаңыз.
Ans. (i) A – Ампициллинге төзімділікD – Тетрациклинге төзімділік E.coli клондау векторында таңдалатын маркерлер ретінде пайдаланылады.
(ii) a-галактозидазаның кодтау тізбегі жақсырақ маркер болып табылады, өйткені рекомбинанттар мен рекомбинанттар хромогенді субстрат болған кезде түс шығару қабілеті негізінде дифференцияланады, ал рекомбинанттар антибиотиктің инактивациясына байланысты таңдалады. төзімді ген оларды бір уақытта екі антибиотикте бөлек өсіру үшін жалықтыратын және уақытты қажет ететін процесс.
(а) а-галактозидазаның кодтау тізбегіне рДНҚ енгізу инсерциялық инактивацияға әкеледі.
(іі) рекомбинанттар көк түс бермейді, ал рекомбинанттар көк түс береді.

52. Рекомбинантты ДНҚ технологиясында қолданылатын ДНҚ фрагменттерін бөлу және оқшаулауда қолданылатын әдістерді атаңыз және түсіндіріңіз.
[Барлық Үндістан 2009]
Ans.Рестрикциялық эндонуклеазаларды қолдану нәтижесінде түзілген ДНҚ фрагменттері гельдік электрофорез арқылы бөлінеді.
(i) ДНҚ фрагменттері теріс зарядты молекулалар. Осылайша, олар орта арқылы электр өрісі астында анодқа қарай жылжиды.
(ii) ДНҚ фрагменттері агароздық гельдің севитивтік әсерінен олардың өлшеміне қарай бөлінеді.
(iii) Бөлінген ДНҚ фрагменттерін ДНҚ-ны этидий бромидімен бояу, содан кейін ультракүлгін сәулелену арқылы көруге болады.
(iv) ДНҚ-ның бөлінген жолақтары кесіліп, гель бөлігінен алынады. Бұл элюция ретінде белгілі.

53. Неліктен антибиотиктердің төзімділігін кодтайтын гендер коли клондау векторы үшін пайдалы таңдамалы маркерлер болып саналады? Бір мысал арқылы түсіндіріңіз. [Дели 2009c]
Ans. Антибиотиктерге төзімділікті кодтайтын гендер пайдалы таңдалатын болып саналады
маркерлер, өйткені қалыпты £. coli жасушалары осы антибиотиктердің ешқайсысына қарсы тұрмайды.
Мысал Бөтен ДНҚ pBR322 векторындағы тетрациклинге төзімділік генінің Bam HI орнында байланыстырылады. Рекомбинантты плазмидтер бөтен ДНҚ-ны енгізуге байланысты тетрациклинге төзімділігін жоғалтады, бірақ ампициллин бар ортаға трансформаторларды жабу арқылы әлі де рекомбинантты еместерден таңдауға болады.
Құрамында ампициллин бар қоректік ортада өсетін трансформаторлар содан кейін тетрациклин бар ортаға тасымалданады. Рекомбинанттар өспейді, ал рекомбинанттар екі антибиотикті де қамтитын ортада өседі. Антибиотиктерге төзімділік гені, осылайша, трансформацияларды таңдауға көмектеседі.

54. (i) Келесі ДНҚ сегменті үшін палиндромды нуклеотидтер тізбегін жазыңыз
5′- GAATTC- 3′

  • Осы тізбекті танитын шектеу эндонуклеазасын атаңыз.
  • Жабысқақ ұштары қалай жасалады? Олардың рөлін атап өтіңіз. [Барлық Үндістан 2009]

Ans. (i) үшін палиндромдық реттілік

5′- GAATTC- 3′
3′- CTTAAG -5′.
(ii) Eco Rl шектеу эндонуклеазасы жоғарыдағы палиндромдық тізбекті таниды.
(iii) ДНҚ-дағы жабысқақ ұштар рестрикциялық эндонуклеаза ферменттерінің әсерінен түзіледі. Бұл ферменттер ДНҚ тізбегін екі жіптегі бірдей екі негіз арасында палиндром тізбегінің ортасынан сәл алыстатады. Бұл олардың ұштарындағы қосымша жіптердің екеуінде де бір жіпті созылуларға әкеледі.
Бұл асып түсетін созылулар жабысқақ ұштар деп аталады, өйткені олар қосымша негіз жұбының тізбектерімен сутегі байланыстарын құрайды.
Жабысқақ ұштардың рөлі Өндірілген бұл жабысқақ ұштар қосымша кесілген әріптестерімен сутегі байланыстарын құрайды. Ұштардың бұл жабысқақтығы ДНҚ лигаза ферментінің әрекетін жеңілдетеді.

55. (i) Молекулярлық қайшылар дегеніміз не?
Бір мысал келтіріңіз.
(ii) Олардың рекомбинантты ДНҚ технологиясындағы рөлін түсіндіріңіз.
[Дели 2008 Шетел 2008]
немесе
(i) ДНҚ молекуласының белгілі бір орнында кесілетін ферменттер категориясын атаңыз. Мысал келтіріңіз.
(ii) Түсіндіріңіз, бұл ферменттер қалай қызмет етеді? Олардың гендік инженерияда қолданылуын атаңыз. [Барлық Үндістан 2008C]
Ans. (i) Молекулалық қайшылар рестрикциялық эндонуклеазалар болып табылады, өйткені олар ДНҚ сегменттерін белгілі бір жерлерде немесе белгілі бір реттілікте кесіп тастайды, мысалы. Eco Rl.
(іі) Рестриктазалар ДНҚ тізбегін палиндромдық учаскелердің ортасынан сәл алыстатады, бірақ қарама-қарсы жіптердегі бірдей екі негіз арасында. Бұл әр жіпте жабысқақ ұштар деп аталатын асып түсетін созылулары бар ұштарында жалғыз жіпті бөліктерді қалдырады. Бұл ұштар қосымша кесілген әріптестерімен сутегі байланыстарын құрайды. Ұштардың бұл жабысқақтығы ДНҚ лигаза ферментінің әрекетін жеңілдетеді.

56. Agrobacterium tumefaciens неліктен жақсы клондаушы вектор болып табылады? Түсіндіріңіз.
[Барлық Үндістан 2008]
Ans. Agrobacterium tumefaciens – көптеген қосжарнақты өсімдіктерде ауру тудыратын топырақ бактериясы. Бұл табиғи вектор, өйткені ол қалыпты жасушаларды ісік жасушаларына айналдыру үшін Т-ДНҚ деп аталатын ДНҚ бөлігін жеткізе алады және осы ісік жасушаларын патогенге қажетті химиялық заттарды өндіруге бағыттай алады.
A. tumefaciens ісік индукциялаушы (Ti) плазмиді қазір өсімдіктер үшін патогенді емес, бірақ өсімдік геномына енгізілген қызығушылық генін жеткізетін клондау векторына өзгертілді.

57. Маңыздылығын түсіндіріңіз
(i) төменде көрсетілген E.coli векторындағы ori (ii) амп R және (iii) роп.
[Барлық Үндістан 2008]
Ans.(i) Ори – репликация басталатын ДНҚ тізбегі және осы реттілікпен байланысқан кезде ДНҚ-ның кез келген бөлігі хост жасушаларында репликациялануы мүмкін.
Ол сонымен қатар байланыстырылған ДНҚ көшірмелерінің санын бақылауға жауапты.
(ii) амп R – антибиотикке төзімділік гені, онда бөгде ДНҚ-ны байлау шектеу орнында жүзеге асырылады.
(iii) плазмиданың репликациясына қатысатын ақуыздардың роп кодтары.

58. Вектор үш ерекшелікпен құрастырылған, бұл оның негізгі ұяшықтағы клондалануын жеңілдетеді. Үш ерекшелікті атап, олардың әрқайсысын түсіндіріңіз.
[Шетелдік 2008]
Ans. Векторды клондауды жеңілдететін мүмкіндіктер:
(i) Репликацияның шығу тегі (Ори)

  • Бұл репликация басталатын ДНҚ тізбегі.
  • Онымен байланысқан бөтен/шетелдік ДНҚ-ның кез келген бөлігі хост жасушасында репликациялану үшін жасалады. Ол сондай-ақ байланыстырылған[ ДНҚ көшірмесінің нөмірін анықтайды.
    (іі) Таңдауға болатын маркер рекомбинантты еместерден трансформанттар/рекомбинанттар болып табылатын хост жасушаларын таңдауға көмектесетін маркер гені.
    Мысалы, ампициллин мен тетрациклинге төзімді гендер, £. coli.
    (iii) Клондау сайты шетелдік ДНҚ-ны байланыстыру үшін вектордағы бірегей тану сайты болып табылады. Белгілі бір клондау/тану сайтының болуы бөліктік шектеу ферментіне векторлық ДНҚ-ны кесуге көмектеседі. Жалғыз тану сайты әдетте таңдалады.
    (iv) Вектордың кіші өлшемі Шағын өлшем ДНҚ-ның иесіне оңай енуін жеңілдетеді.

59. Неліктен жасуша ДНҚ-ны қабылдауға қабілетті болуы керек? Бактерия жасушалары плазмиданы/рДНҚ-ны қабылдауға қабілетті ету кезеңдерін түсіндіріңіз. [Дели 2008C]

Ans. ДНҚ гидрофильді молекула болғандықтан жасуша мембранасынан өте алмайды. Демек, бактерия жасушасы ДНҚ молекуласын қабылдауға қабілетті болады. Сонымен, құзыреттілік - бұл жасушаның бөгде ДНҚ-ны қабылдау қабілеті.
Бактериялық жасушаны сауатты ету үшін келесі әдістер қолданылады:
бактериялар ДНҚ молекулаларын қабылдауға қабілетті болуы керек,
(i) Құзыреттілік жасушаның бөгде ДНҚ-ны қабылдау қабілеті.
(ii) ұяшықты сауатты ету әдістері төмендегідей.
а) Химиялық әдіс Бұл әдісте жасуша қабырғасындағы кеуектер көлемін ұлғайту үшін жасуша кальций сияқты екі валентті катионның белгілі бір концентрациясымен өңделеді.

  • Содан кейін жасушалар мұзда рекомбинантты ДНҚ-мен инкубацияланады, содан кейін орналастырылады
  • оларды 42°C температурада қысқа мерзімге, содан кейін мұзға қайта салыңыз. Бұл термиялық соққымен өңдеу деп аталады.
    • Бұл бактериялардың рекомбинантты ДНҚ қабылдауына мүмкіндік береді.
    (b) Физикалық әдістер Бұл әдісте рекомбинантты ДНҚ микроинъекция әдісімен жануар жасушасының ядросына тікелей енгізіледі.
    • Өсімдіктерде жасушалар алтынның жоғары жылдамдықтағы микробөлшектерімен бомбаланады немесе
    ДНҚ-мен қапталған вольфрам биолистикалық немесе гендік қару әдісі деп аталады.
    (c) Қарусыздандырылған патогенді тасымалдаушылар жасушаны жұқтыруға рұқсат етілгенде, рекомбинантты ДНҚ-ны иесіне тасымалдаңыз.

60. Белгілі бір ДНҚ тізбегінің келесі негізгі тізбегін оқыңыз және келесі сұрақтарға жауап беріңіз:

  • ДНҚ-дағы палиндромдық тізбекті не деп атайды?
  • Берілген ДНҚ тізбегінде көрсетілген палиндромды нуклеотидтер тізбегін жазыңыз және мұндай тізбекті танитын ферментті атаңыз.
  • Палиндромды нуклеотидтер тізбегін анықтайтын ферменттердің маңызын көрсетіңіз. [Барлық Үндістан 2008C]

Ans. (i) ДНҚ-дағы палиндромдық реттілік – алға және кері бағытта бірдей оқылатын негізгі тізбектер.
(ii) ДНҚ 5′- GAATTC- 3′-дегі палиндромды тізбек
3 – CTTAAG- 5′
5′-> 3′ бағыттағы екі жіпте реттілік бірдей оқылады. Бұл 3′->5′ бағытында оқылса да бірдей. Рестрикциялық эндонуклеаза мұндай тізбекті таниды.
ДНҚ гидрофильді молекула болғандықтан жасуша мембранасынан өте алмайды. Демек, бактерия жасушасы ДНҚ молекуласын қабылдауға қабілетті болады. Сонымен, құзыреттілік - бұл жасушаның бөгде ДНҚ-ны қабылдау қабілеті.
Бактериялық жасушаны сауатты ету үшін келесі әдістер қолданылады:
бактериялар ДНҚ молекулаларын қабылдауға қабілетті болуы керек,
(i) Құзыреттілік жасушаның бөгде ДНҚ-ны қабылдау қабілеті.
(ii) ұяшықты сауатты ету әдістері төмендегідей.
а) Химиялық әдіс Бұл әдісте жасуша қабырғасындағы кеуектер көлемін ұлғайту үшін жасуша кальций сияқты екі валентті катионның белгілі бір концентрациясымен өңделеді.

оларды 42°C температурада қысқа мерзімге, содан кейін мұзға қайта салыңыз. Бұл термиялық соққымен өңдеу деп аталады.
• Бұл бактериялардың рекомбинантты ДНҚ қабылдауына мүмкіндік береді.
(b) Физикалық әдістер Бұл әдісте рекомбинантты ДНҚ микроинъекция әдісімен жануар жасушасының ядросына тікелей енгізіледі.
• Өсімдіктерде жасушалар алтынның жоғары жылдамдықтағы микробөлшектерімен бомбаланады немесе
ДНҚ-мен қапталған вольфрам биолистикалық немесе гендік қару әдісі деп аталады.
(c) Қарусыздандырылған патогенді тасымалдаушылар жасушаны жұқтыруға рұқсат етілгенде, рекомбинантты ДНҚ-ны иесіне тасымалдаңыз.
Рестрикциялық эндонуклеазалардың маңызы Олар гендік инженерияда ДНҚ рекомбинантты молекулаларын түзу үшін қолданылады,
олар әртүрлі көздерден/геномдардан алынған ДНҚ-дан тұрады және генерацияланған жабысқақ ұштары арқасында қажетті ген фрагментін бөліп алуға және оны векторлық ДНҚ-дағы хостпен біріктіруге мүмкіндік береді.
5 Бағалық сұрақтар

61. (i) Клондау векторы болуы тиіс сипаттарды сипаттаңыз.
(ii) Неліктен ДНҚ жасуша мембранасынан өте алмайды? Түсіндіріңіз. Бактерия жасушасы ортадан рекомбинантты ДНҚ-ны қабылдауға қалай қабілетті? [Барлық Үндістан 2011]
Жауап (I) Векторға клондауды жеңілдету үшін келесі мүмкіндіктер қажет
Векторды клондауды жеңілдететін мүмкіндіктер:
(i) Репликацияның шығу тегі (Ори)

  • Бұл репликация басталатын ДНҚ тізбегі.
  • Онымен байланысқан бөтен/шетелдік ДНҚ-ның кез келген бөлігі хост жасушасында репликацияланады. Ол сондай-ақ байланыстырылған[ ДНҚ көшірмесінің нөмірін анықтайды.

(іі) Таңдауға болатын маркер рекомбинантты еместерден трансформанттар/рекомбинанттар болып табылатын хост жасушаларын таңдауға көмектесетін маркер гені.
Мысалы, ампициллин мен тетрациклинге төзімді гендер, £. coli.
(iii) Клондау сайты шетелдік ДНҚ-ны байланыстыру үшін вектордағы бірегей тану сайты болып табылады. Белгілі бір клондау/тану сайтының болуы бөліктік шектеу ферментіне векторлық ДНҚ-ны кесуге көмектеседі. Жалғыз тану сайты әдетте таңдалады.
(iv) Вектордың кіші өлшемі Шағын өлшем ДНҚ-ның иесіне оңай енуін жеңілдетеді.
(II) ДНҚ гидрофильді молекула болғандықтан жасуша мембранасынан өте алмайды. Демек, бактерия жасушасы ДНҚ молекуласын қабылдауға қабілетті болады. Сонымен, құзыреттілік - бұл жасушаның бөгде ДНҚ-ны қабылдау қабілеті.
Бактериялық жасушаны сауатты ету үшін келесі әдістер қолданылады:
бактериялар ДНҚ молекулаларын қабылдауға қабілетті болуы керек,
(i) Құзыреттілік жасушаның бөгде ДНҚ-ны қабылдау қабілеті.
(ii) ұяшықты сауатты ету әдістері төмендегідей.
а) Химиялық әдіс Бұл әдісте жасуша қабырғасындағы кеуектер көлемін ұлғайту үшін жасуша кальций сияқты екі валентті катионның белгілі бір концентрациясымен өңделеді.

оларды 42°C температурада қысқа мерзімге, содан кейін мұзға қайта салыңыз. Бұл термиялық соққымен өңдеу деп аталады.
• Бұл бактериялардың рекомбинантты ДНҚ қабылдауына мүмкіндік береді.
(b) Физикалық әдістер Бұл әдісте рекомбинантты ДНҚ микроинъекция әдісімен жануар жасушасының ядросына тікелей енгізіледі.
• Өсімдіктерде жасушалар алтынның жоғары жылдамдықтағы микробөлшектерімен бомбаланады немесе
ДНҚ-мен қапталған вольфрам биолистикалық немесе гендік қару әдісі деп аталады.
(c) Қарусыздандырылған патогенді тасымалдаушылар жасушаны жұқтыруға рұқсат етілгенде, рекомбинантты ДНҚ-ны иесіне тасымалдаңыз.62. (i) Эко RI рестриктазалық эндонуклеаза ферментінің әсерінен рекомбинантты ДНҚ түзілуінің әртүрлі кезеңдерін диаграммалардың көмегімен көрсетіңіз.
(ii) Рестриктазалық эндонуклеазалар арқылы кесілген ДНҚ фрагменттерін бөлу үшін қолданылатын әдісті атаңыз. [Барлық Үндістан 2011]
Ans. (i) Eco Rl рестрикциялық эндонуклеаза ферментінің әсерінен рекомбинантты ДНҚ түзілуі.
Рестриктеуші фермент екі ДНҚ тізбегін бір жерде кесіп, жабысқақ ұштарды шығарады.
(а) Рестрикциялық ферменттер ДНҚ тізбегін палиндром ошақтарының ортасынан сәл алыстатады, бірақ қарама-қарсы жіптердегі бірдей екі негіз арасында.
(b) Бұл ұштарында бір жіпті бөліктерді қалдырады.
(c) Жоғарыдағы суретте көрсетілгендей әрбір жіпте жабысқақ ұштар деп аталатын асып түсетін созылулар бар. Олар осылай аталды, өйткені олар қосымша кесілген аналогтарымен сутектік байланыс түзеді.
г) Ұштарының жабысқақтығы ДНҚ лигаза ферментінің әрекетін жеңілдетеді.
(е) Рестрикциялық эндонуклеазалар гендік инженерияда әртүрлі көздерден/геномдардан алынған ДНҚ-дан тұратын ДНҚ-ның рекомбинантты молекулаларын қалыптастыру үшін қолданылады.
(f) Бұл жабысқақ ұштар бір шектеуші ферментпен кесілген кезде бір-бірін толықтырады, сондықтан ДНҚ лигазалары арқылы біріктірілуі мүмкін.
(ii) гельдік электрофорез.

63. (i) Неліктен биотехнологтар қажетті гендерді басқа ағзаға тасымалдау үшін инженерлік векторларды таңдайды?(ii) Түсіндіріңіз, ори, таңдалатын маркер және клондау сайттары векторға клондауды қалай жеңілдетеді? [Шетелдік 2009]
Ans. (I) Инженерлік векторларды биотехнологтар таңдайды, өйткені олар шетелдік ДНҚ-ны оңай байланыстыруға және рекомбинантты емес рекомбинантты таңдауға көмектеседі.
(II) Векторды клондауды жеңілдететін мүмкіндіктер:
(i) Репликацияның шығу тегі (Ори)

  • Бұл репликация басталатын ДНҚ тізбегі.
  • Онымен байланысқан бөтен/шетелдік ДНҚ-ның кез келген бөлігі хост жасушасында репликацияланады. Ол сондай-ақ байланыстырылған[ ДНҚ көшірмесінің нөмірін анықтайды.

(іі) Таңдауға болатын маркер рекомбинантты еместерден трансформанттар/рекомбинанттар болып табылатын хост жасушаларын таңдауға көмектесетін маркер гені.
Мысалы, ампициллин мен тетрациклинге төзімді гендер, £. coli.
(iii) Клондау сайты шетелдік ДНҚ-ны байланыстыру үшін вектордағы бірегей тану сайты болып табылады. Белгілі бір клондау/тану сайтының болуы бөліктік шектеу ферментіне векторлық ДНҚ-ны кесуге көмектеседі. Жалғыз тану сайты әдетте таңдалады.
(iv) Вектордың кіші өлшемі Шағын өлшем ДНҚ-ның иесіне оңай енуін жеңілдетеді.


EcoRI шектеу орны қалай реттелген? - Биология

Шектеу сайттар, немесе шектеу тану учаскелері - бұл нуклеотидтердің белгілі бір тізбегі шектеу ферменттер. Сайттар әдетте палиндромикалық және ерекше шектеу фермент оның ішіндегі екі нуклеотидтер арасындағы тізбекті үзуі мүмкін.
Толық мақала >>>

А шектеу фермент – екі жіпті немесе бір тізбекті ДНҚ-ны нуклеотидтердің белгілі тану тізбегінде кесетін фермент. шектеу сайттар. Бактериялар мен архейлерде кездесетін мұндай ферменттер бар деп есептеледі.
Толық мақала >>>

Қалай қосуға болады Сайт Internet Explorer браузеріне Шектеулі Сайттар Аймақ? . Өйткені біз бұл туралы айтып отырмыз Шектеулі Сайттар сіз қалаған аймақ.
Толық мақала >>>

Табады шектеу эндонуклеазаның ыдырауы сайттар ДНҚ тізбегінде. Сызықтық және айналмалы ДНҚ-ны қолдайды және шығысты сұрыптаудың және сүзудің бірнеше жолдарын қамтамасыз етеді.
Толық мақала >>>

CLC bio әлемдік деңгейдегі биоинформатика шешімдерінің кең ауқымын ұсынады: Жоғары жетілдірілген дәйектілік талдауынан. интерактивті шектеу сайт талдау.
Толық мақала >>>

CLC bio әлемдік деңгейдегі биоинформатика шешімдерінің кең ауқымын ұсынады: Жоғары жетілдірілген дәйектілік талдауынан. Шектеу сайт анықтау. Кері.
Толық мақала >>>

. Microsoft Internet Explorer шолғышындағы аймақтарды және веб үшін қауіпсіздіктің әртүрлі деңгейлерін қалай конфигурациялау керек сайттар сіз баратыныңыз. . сайт дейін Шектеулі Сайттар аймақ, .
Толық мақала >>>

көрсетеді шектеу сайттар Fermentas ферменттерінің сезімталдығы (бөлінуі. Жоқ шектеу сайттар PhiX174 ДНҚ-да келесі ферменттер үшін: .
Толық мақала >>>

көрсетеді шектеу сайттар Fermentas ферменттерінің сезімталдығы (бөлінуі. Жоқ шектеу сайттар M13mp18 ДНҚ-да келесі ферменттер үшін: .
Толық мақала >>>

шектеу сайт синонимдер, шектеу сайт антонимдер. Туралы ақпарат шектеу сайт . шектеу-сайт полиморфизм. Шектеу. шектеушілік.
Толық мақала >>>

Шектеулі Сайт. Бұл сайт Солтүстік-Шығыс Джорджия кеңесінің қызметкерлеріне арналған, Boy . осы интернетте қамтылған құпия немесе жеке ақпарат сайт. .
Толық мақала >>>

Бұл мақалада қалаусыз жарнамаларды, баннерлерді, қалқымалы терезелерді, паразиттерді, ұрлаушыларды және іздеу жүйелерін блоктау туралы мәліметтер берілген. Шектеулі Аймақ
Толық мақала >>>

Дегенерацияланған тізбектер Талдау шектеу реттілік карталары. Сізге қалай ұнайтыныңызды көрсетіңіз шектеу сайттар көрсетіледі. картасы шектеу сайттар .
Толық мақала >>>

Сіз біздің тізімді көре аласыз шектелген сайттар өте үлкен. . А қосайық сайт дейін Шектеулі Сайттар тізім. Жазбаның форматына назар аударыңыз. .
Толық мақала >>>

Соғыс кезінде серферлер қалай жол табады шектелген немесе цензураға ұшырайды сайттар . Екеуінде де бар шектелген тегін нұсқалары. Мыналар сайттар орналасқан жеріңізді жасырыңыз және қорғаңыз.
Толық мақала >>>

Сайттар жоғары қауіпсіздік аймағына орналастырылады, содан кейін болады шектелген қол жеткізуде. Сіз қорғалғансыз, егер а сайт сенің ішіңде шектелген аймақ. .
Толық мақала >>>

Ұзындығы шектеу тану сайттар өзгереді: EcoRI, SacI және ферменттері. Басқа шектеу ферменттер бірдей тануға ие болуы мүмкін сайт - осындай ферменттер.
Толық мақала >>>


G-протеин сигнализациясының реттегіштері, В бөлімі

Патриция Тосетти, Кэтлин Данлап, энзимологиядағы әдістер, 2004 ж.

Репликацияға қабілетті ретровирустарды өндіру.

A 5′ Xba I шектеу орны (TCT AGA), одан кейін аударма/транскрипция аксессуарлар тізбегі (CCA CGT TGG CCA GGC GGT AGC TGG GAC GTG CAG CCG ACC ACC) және 3′ HA эпитопы (TAC GAC GTG CCC GAC TAC GCC), одан кейін тоқтайды. кодон (TAG) және а ХинdIII шектеу орны (AAG CTT) сәйкес реттілігі бар праймерлерді пайдалана отырып, ПТР арқылы RGS3 нұсқадағы cDNA-ға кадр ішінде құрастырылған. Содан кейін ПТР өнімдері қорытылады және кадрға субклондалады Xbaмен/ХинdIII адаптер плазмиді Cla12 NCO сайттары. Қызығушылықты тудыратын тізбектер содан кейін адаптер плазмидасынан алынады ClaМен асқорытамын және бағытына қарай субклондаймын ClaB кіші тобының RCASBP ретровирустық нұсқаларының I сайты (екі плазмида да доктор Донна Фекетенің жомарт сыйы болды, Пурдю университеті, Вест Лафайетт, IN). Барлық байлаулар өндірушінің нұсқауларына сәйкес Boehringer Mannheim (Индианаполис, IN) компаниясының жылдам ДНҚ байлау жинағы арқылы жүзеге асырылады. Реттеу ферменттері New England Biolabs компаниясынан (Беверли, MA). Дұрыс бағдарланған конструкциялар ПТР және секвенирлеу арқылы анықталады.


Сондай-ақ ферменттерді реттілік бойынша қай жерде немесе қанша рет кесу арқылы сүзуге болады. Мысалы, жалғыз немесе қос кескіш болып табылатын ферменттерді ғана көру үшін сүзуге болады. Ағымдағы таңдауыңыздан тыс кез келген жерде кесетін ферменттерді де көруге болады.

Дайджесттер тақтасын жабу үшін қайшы белгішесін қайта басыңыз. Реттік картадағы кесілген жерді екі рет басыңыз және фермент туралы қосымша ақпаратты көрсету үшін панель автоматты түрде ашылатынын байқаңыз.


Шектеу-модификация жүйесіне байланысты бактериялық аутоиммунды

Шектеу-модификациялау (РМ) жүйелері прокариоттарда [1] өзін-өзі/өзіндік емес дискриминацияның минималды және барлық жерде кездесетін биологиялық жүйесін білдіреді, ол хосттарды экзогендік ДНҚ-дан қорғайды [2]. Механизм метилтрансфераза (M) мен туыстық рестрикциялық эндонуклеаза (R) арасындағы тепе-теңдікке негізделген. M рестрикциялық учаскелер деп аталатын қысқа спецификалық ДНҚ тізбектерін метилдеу арқылы эндогендік ДНҚ-ны өздігінен белгілейді, ал R метилденбеген шектеу учаскелерін өздігінен емес деп таниды және қос тізбекті ДНҚ үзілуін енгізеді [3]. Шектеу орындары прокариоттық геномдарда айтарлықтай аз көрсетілген [4-7], бұл дискриминация механизмінің жетілмегендігін және кейде ДНҚ-ның өздігінен бөлінуіне (өзін-өзі шектеу) байланысты аутоиммундылыққа әкеледі [8]. Сонымен қатар, RM жүйелері ДНҚ рекомбинациясына ықпал ете алады [9] және микробтық популяциялардағы генетикалық вариацияға ықпал етеді, осылайша адаптивті эволюцияны жеңілдетеді [10]. Дегенмен, прокариоттық геномдарды қалыптастыратын элементтер ретінде RM жүйелерінің өзіндік ДНҚ-ның бөлінуі тікелей анықталған жоқ және оның себебі, жиілігі және нәтижесі белгісіз. Біз ішек таяқшасының екі RM жүйесі тудырған өзін-өзі шектеуді сандық түрде анықтаймыз және шектеу аймағын болдырмау деңгейлерімен келісе отырып, EcoRV емес, EcoRI өлшенетін жылдамдықпен өзіндік ДНҚ-ны бөлетінін анықтаймыз. Өзін-өзі шектеу - бұл стохастикалық процесс, ол уақытша SOS-жауапты индукциялайды, содан кейін жасуша өміршеңдігін сақтай отырып, ДНҚ репарациясы жүреді. Біз бактериофагтық инфекцияларға қарсы шектеу тиімділігі жоғары RM жүйелерінің өзін-өзі шектеудің жоғары жылдамдығын көрсететінін және бұл жылдамдықты R және M арасындағы стохастикалық теңгерімсіздік арқылы одан әрі арттыруға болатынын анықтаймыз. Біздің нәтижелеріміз RM жүйелеріндегі молекулалық шуды прокариоттарды қалыптастыратын фактор ретінде анықтайды. геномдар.


Шектеу алаңдарының жиілігі

Төмендегі кестеде жиі қолданылатын ДНҚ молекулаларында рестрикциялық эндонуклеаза учаскелерінің пайда болу жиілігі жинақталған. Егжей-тегжейлі шектеу карталарын ДНҚ тізбегі мен карталарынан табуға болады. Осы кестелерде көрсетілген сайттар жарияланған тізбектерді компьютерлік талдау арқылы анықталды. Біз олардың дәлдігін қамтамасыз етуге тырысқанымызбен, сайттар эксперимент арқылы расталған жоқ. Бірдей ерекшелікті бірнеше ферменттер көрсеткенде, сайт New England Biolabs-тен қол жетімді фермент атауымен тізімделеді. Бірдей спецификалық басқа ферменттер изошизомерлер кестесінде келтірілген. Тану тізбегі 5&акуттан 3&өткірге дейін жазылады.

DNASU - бұл пайдалы болуы мүмкін плазмидтік клондар мен жинақтардың орталық репозиторийі.

Фермент Тану реті Адено-2 Ламбда** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNNN/NNNNNNNNNN
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
I § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
Ахди GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
АпаI GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
АпаЛИ G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
АсеI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 1 8 7 9 6 6 8 2 54
АврII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
БанII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF ® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI GTCTC(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI GTGCAG(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF ® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNNN/NNNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI GTCTC(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF ® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
EarI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Эко53кI GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI /CATG 183 181 14 26 38 23 21 23 31 11 148
ФауИ CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI CC(12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
ХхаИ GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
КасІ G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG(10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CCG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
НаИ GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
НарІ GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
емесI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/Y 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI GTCTC(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PCI A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
ПшаАИ GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
RsaI GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
SwaI ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
ЦеИ G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
XmaI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI GAC/GTC 3 10 0 1 0 0 5 1 0 1 1

§ Бұл ферменттің HF нұсқасы бар.

* M13mp18 үшін тек қос тізбекті аймақтар кесіледі.
** Жабайы типтегі ДНҚ субстратына қатысты Hind III жабайы типті ламбда фагының ДНҚ-сында 6 шектеу орны бар, ал NEB ламбда фагының мутантында (Lambda DNA, NEB #N3011) 7 Hind III сайты бар.


Шектеу алаңдарының жиілігі

Төмендегі кестеде жиі қолданылатын ДНҚ молекулаларында рестрикциялық эндонуклеаза учаскелерінің пайда болу жиілігі жинақталған. Егжей-тегжейлі шектеу карталарын ДНҚ тізбегі мен карталарынан табуға болады. Осы кестелерде көрсетілген сайттар жарияланған тізбектерді компьютерлік талдау арқылы анықталды. Біз олардың дәлдігін қамтамасыз етуге тырысқанымызбен, сайттар тәжірибе арқылы расталған жоқ. Бірдей ерекшелікті бірнеше ферменттер көрсеткенде, сайт New England Biolabs-тен қол жетімді фермент атауымен тізімделеді. Бірдей спецификалық басқа ферменттер изошизомерлер кестесінде келтірілген. Тану реті 5&акуттан 3&өткірге дейін жазылады.

DNASU - бұл пайдалы болуы мүмкін плазмидтік клондар мен жинақтардың орталық репозиторийі.

Фермент Тану реті Адено-2 Ламбда** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNNN/NNNNNNNNNN
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AcuI CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
I § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
Ахди GACNNN/NNGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
АпаI GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
АпаЛИ G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
АсеI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 1 8 7 9 6 6 8 2 54
АврII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
БанII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF ® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI GTCTC(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI GTGCAG(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF ® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNNN/NNNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI GTCTC(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF ® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NNGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI Y/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
EarI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Эко53кI GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
FatI /CATG 183 181 14 26 38 23 21 23 31 11 148
ФауИ CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI CC(12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
ХхаИ GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/CGT 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
I-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
КасІ G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG(10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CCG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
НаИ GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
НарІ GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
емесI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/Y 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI GTCTC(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
PacI TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PCI A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
ПшаАИ GACNN/NNGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
RsaI GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
SwaI ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
ЦеИ G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NNGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
XmaI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI GAC/GTC 3 10 0 1 0 0 5 1 0 1 1

§ Бұл ферменттің HF нұсқасы бар.

* M13mp18 үшін тек қос тізбекті аймақтар кесіледі.
** Жабайы типтегі ДНҚ субстратына қатысты Hind III жабайы типті ламбда фагының ДНҚ-сында 6 шектеу орны бар, ал NEB ламбда фагының мутантында (Lambda DNA, NEB #N3011) 7 Hind III сайты бар.